Patent Application 17846636 - NOVEL RNA THERAPEUTICS AND USES THEREOF

Title: NOVEL RNA THERAPEUTICS AND USES THEREOF

Application Information

Invention Title: NOVEL RNA THERAPEUTICS AND USES THEREOF
Application Number: 17846636
Submission Date: 2025-05-20T00:00:00.000Z
Effective Filing Date: 2022-06-22T00:00:00.000Z
Filing Date: 2022-06-22T00:00:00.000Z
National Class: 514
National Sub-Class: 04400A
Examiner Employee Number: 97139
Art Unit: 1637
Tech Center: 1600

Rejection Summary

102 Rejections: 0
103 Rejections: 2

Cited Patents

No patents were cited in this rejection.

Office Action Text

DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 07/22/2024 has been entered.
Claims 1, 3-27 are pending. Claims 1, 3-13 are examined here, along with elected species of SEQ ID NO: 256.
Claims 14-27 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Priority
Application’s benefit to U.S. Provisional Applications 63/214, 584, filed on 06/24/2021, and 63/214,555, filed on 06/24/2021, is acknowledged. Claims 1-13 enjoy the benefit of 06/24/2021.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 07/22/2024 and 01/16/2025 were filed before the mailing date of the first Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.

Claim Rejections - 35 USC § 112
35 U.S.C. 112(b):

The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.

The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.

Claims 1, 3-13 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites a structure “R” in Formula I. Formula I structure lacks a “R.” In the interest of compact prosecution, R is understood to be enumerated as indicated on Formula I illustrated in the specification pg. 20, and recopied below.

PNG
media_image1.png
198
310
media_image1.png
Greyscale

35 U.S.C. 112(d):
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.

The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.

Claims 6-13, are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claims 6 and 7 recite “or a sequence having at least 90% sequence identity thereto.” The term “a sequence,” under BRI, is interpreted as any sequence and therefore can be a sequence of at least 10 nucleotides (nt.) as defined in “oligonucleotide,” which includes “the sense strands or antisense strands disclosed herein, means at least 10 nucleotide.” Thus, a strand of 10 nt. is broader in scope than the requirement of claim 1, which requires a 18 nt. long strand of recited SEQ ID NOs. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claims 8-13 also depend on claims 6 and 7, thus are rejected for failing to overcome the 112d rejection.
Claim Rejections - 35 USC § 103
Rejection of claims 1, 3-13 is maintained as noted below and the rejection is edited to reflect the claim amendments.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.

The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1, 3-8, 13 are rejected under 35 U.S.C. 103 as being unpatentable over Delacote et al. (US20120244131, pub. 09/27/2012) in view of Amarzguioui et al. (2005, FEBS Letters, 579, pg. 5974-5981) and Li et al. (US20180064819, pub. 03/08/2018, referred as Li) and Matsuda et al. (2015, ACS Chem. Biol. 10, 1181-1187) and K.
Regarding instant claim 1, SEQ ID NOs: 417-420 have at least 18 contiguous nt. identical to elected SEQ ID NO: 256 (Antisense): ugugcggccauagagacccagua, a 23 nt. sequence, while the complementary sense strand is SEQ ID NO: 133, 5' – cugggucucuauggccgcaca, a 21 nt. sequence (all sequence are from 5’ to 3’ unless indicated otherwise). It should be noted that SEQ ID NO: 256 comprises two nt. overhangs at the 3’ end of the antisense strand comprising nts. U and A, and the overhang is not complementary with the target sequence.
Delacote discloses a novel approach to increase the efficiency of DSB-induced mutagenesis by using of interfering agents in an in vivo assay (par. 13). Following a screen to identify genes involved in DSB-mutagenesis repair, one of the 481 siRNA hit stimulated an endonuclease induced mutagenic NHEJ repair luciferase signal with at least a stimulation factor of 1.83 and targeted a sequence of SEQ ID NO: 555 (par. 283). The siRNA targeting SEQ ID NO: 555 was expressed on a vector and targeted the following sequence SEQ ID NO: 555: ctggguctctatggccgcaca (Table IV, par. 284). SEQ ID NO: 555, once expressed with a uracil, is 100% identical to instant sense sequence SEQ ID NO: 133, thus, inherently, the antisense strand at 100% complementary of SEQ ID NO: 555 reads on instant SEQ ID NOs: 417-420 (relevant to instant cl. 1, 3, 7). Delacote discloses that siRNAs duplex comprises 21 and 23 nt. (par. 124, relevant to instant cl. 4 and 5) and can be generated from two RNA molecules that hybridize together without a mismatch or with one or more mismatch (par. 125, relevant to instant cl. 8).
Regarding instant cl. 13, the limitation of “a phosphate group,” analyzed broadly, would include a phosphodiester bond, which comprises a phosphate group. Thus, the 5’ nucleotide of the antisense strand bound to position 2 via a phosphodiester bond would necessarily have “a phosphate group”. Here, the specification does not clearly define “a phosphate group,” the specification describes a phosphate group as a phosphodiester linkage (see pg. 10, line 23-25: A modified deoxyribonucleotide has one or more modifications . . . including modifications or substitutions in or of the nucleobase, sugar, or phosphate group”).
Delacote does not disclose a non-vector based siRNA and a R moeity of claim 1.
Amarzguioui et al. (2005, FEBS Letters, 579, pg. 5974-5981) compares chemically synthesized siRNA and vector mediated RNAi and notes advantages of each; the chemically synthesized siRNA representing a “gold standard for RNAi applications” because of its uniform composition and its ability for wider range of chemical modifications, however note that the inhibition is transient, lasting only days in cell culture (pg. 5975, 5976). While the vector based is a stable-expression of RNAi effector molecules for cell lines that are difficult to or are inconsistent in transfecting (pg. 5976). Amarzguioui discloses that changing a siRNA from 19 + UU overhangs to 21 + AA overhangs (thus a 23 nt. sequence), with a 21 nt. target complementary duplex region was associated with enhanced RNAi activity and indicates that increased potency was observed with 5’ overhangs or blunt ends (pg. 5975, relevant to instant cl. 1, 4 and 5).
Delacote and Amarzguioui do not disclose the siRNA with delivery moiety of Formula I conjugated to the siRNA (cl. 1).
Li discloses RNAi agents conjugated to N-acetyl-galactosamine (GalNAc or NAG) targeting ligand via linkers that bind to asialoglycoprotein receptor (ASGPR) on liver cells thus aiding in delivery of RNAi agents to liver cells (par. 94). Li tested various siRNAs NAGs in mice, one is NAG25 (see structure below, Fig 9, also similar structures at par. 17 (structure 1002a, 1003a)), which has prolonged potent inhibitory activity in vivo (see Fig. 12, which shows 71% knockdown, 14, 15). The NAG25 is conjugated at the 5’ end of a sense strand (par. 519, Table 3, Duplex ID: AD03549).

PNG
media_image2.png
230
360
media_image2.png
Greyscale

Li’s NAG25 is similar in structure as instant Formula I. Both have a triantennary GalNAc bound to siRNA with a linker that has a similar branch structure. The distinction is in the structure of the linker: Li’s linker has a polyethylene glycol chain as opposed to instant 4-carbon chain of Formula I, Li’s NAG 25 lacks a tertiary amine, and the orientation of the amide groups are different.
Matsuda et al. (2015, ACS Chem. Biol. 10, 1181-1187) disclosed that evaluating clustered and dispersed incorporation of GalNAc units to the sense strand indicated that sugar proximity is critical for ASPGR recognition, and location of the clustered ligand impacts the intrinsic potency of the siRNA (abstract, see Fig. 1 below for placements of GalNAc moiety).

PNG
media_image3.png
523
789
media_image3.png
Greyscale

The results of Table 1 disclose that compared to the parent design (i.e. labeled I above, a triantennary GalNAc), a monovalent GalNAc moiety bound at 2’ position (labeled II in figure above and compounds 42-44, and 48 in Table 1) that were clustered ligands (all three modified nt. with a monovalent GalNAc moiety are contiguous) near either the 5’ or 3’ ends of the sense strand had in vitro potency similar to or slightly better than that of the parent design under receptor-mediated free uptake conditions (i.e. without transfection agent, pg. 1183). Design II has polyethylene glycol and lacks amide group, while design III has carbon chain with amide group and results with both design have similar inhibitory outcome (see compounds 52 and 54, respectively). The compounds where the monovalent GalNAc was dispersed throughout the siRNA (i.e. two modified nt. with a single GalNAc moiety at terminal positions and one dispersed in a central location on the sense strand, compounds 49-50) showed a significant loss of potency under free uptake condition. The results indicate that “efficient receptor binding and hepatocellular uptake require multiple GalNAc units in close proximity to each other” (pg. 1183-1184). Thus, the essential importance is having the GalNAc/NAG moieties in close proximity and minor structural differences of the linker molecule do not affect the ability to inhibit the target gene.
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified SEQ ID NO: 555 of Delacote in view of Amarzguioui, which discloses synthetic siRNA can be chemically modified, and Li, which discloses modified siRNAs with a GalNAc conjugate tethered by a linker, and arrive at the claimed invention with a reasonable expectation of success. Based on Delacote’s screen using a siRNA expressed on a vector, a skilled artisan would confirm the results using synthetic siRNA because they can be modified and are a “gold standard” as indicated by Amarzguioui and would introduce a GalNAc moiety by the use of a linker, which clusters the GalNAc moieties together, of Li in hepatocyte to confirm if SEQ ID NO: 555 increases the efficiency of DSB-induced mutagenesis in both hepatocytes and in-vivo. The modifications based on Amarzguioiu and Li of SEQ ID NO: 555 of Delacote would successfully result in siRNA at least being incorporated into hepatocyte cell without a transfection agent and be able to confirm the screen results. Thus, claims 1, 3, 4, 5, 7, 8, 13 are obvious.
Regarding instant cl. 6, a siRNA of Li comprising SEQ ID NO: 555 would also comprise identical 21 nt. of instant SEQ ID NO: 256, except for the UA overhang. As indicated by Amarzguioui, an overhang nt. can comprise either an U or A and thus obviously U and A can be interchangeable or substituted, since the overhang do not bind to the target transcript. Thus claim 6 is obvious.
Claims 9, 10, 11, and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Delacote et al. (US20120244131, pub. 09/27/2012) in view of Amarzguioui et al. (2005, FEBS Letters, 579, pg. 5974-5981) and Li et al. (US20180064819, pub. 03/08/2018, referred as Li) and Matsuda et al. (2015, ACS Chem. Biol. 10, 1181-1187) as applied to claims 1, 3, 4, 5, 6, 7, 8, 13 above, and further in view of Khvorova and Watts (2017, Nature Biotech., 35, 238-248, referred as Khvorova).
Regarding instant cl. 9, 10, 11, and 12, Li provides example of RNAi agents with each nucleotide, either with 2’-O-methyl (2OMe) modification or 2’-fluoro (2F) modification (par. 519, see below of Duplex ID: AD03549 comprising NAG25, Table 3, lower case is 2OMe modified nt. and upper case letter with f is 2F modified nt. (par. 301), and results provided in Fig. 12, relevant to instant cl. 9, 10). Further, the RNAi agent comprise phosphorothioate (PS) linkage, with the antisense strand of Duplex ID AD03549 with 4 PS linkage while the sense strand has 2 PS linkage (see above, s is PS linkage, par. 303) (relevant to instant cl. 11). Li discloses that any nucleotide can be modified with a modified internucleotide linkage, including modified PS linkage between linker and siRNA, thus based on numbers of internucleotide linkage, each linkage could be a PS linkage (par. 119, relevant to instant cl. 12). These modifications provide a potent inhibitory effect as seen in results of Fig. 12.

PNG
media_image4.png
112
510
media_image4.png
Greyscale

Khvorova discloses that nucleotide modifications, including 2OMe, 2F and PS linkages, are required to be sufficiently active in vivo with PS linkage providing nuclease stability, while 2OMe and 2F improve binding affinity and nuclease resistance (pg. 239, relevant to instant cl. 9-12). Khvorova discloses that PS linkages at every internucleotide site result in reduced binding affinity (pg. 239) thus suggests that two terminal linkages of each strand should be modified with PS; thus each sense and antisense strand has 4 PS linkages (see Fig. 3, pg. 243 (“limited phosphorothioates”), relevant to instant cl. 12).
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the SEQ ID NO: 555 of Delacote in view of Amarzguioui, Li and Khvorova arrive at the claimed invention with a reasonable expectation of success. Here, Amarzguioui discloses the use of synthetic siRNA based on its ability to be modified as an advantage and Li provides a NAG, 2OMe, 2F and PS-linkage modified form of an siRNA that provide nuclease stability and improved binding and results in successful inhibitory activity of target gene, and Khvorova discloses a limited modification of siRNA with PS linkages, thus, a synthetic, fully modified siRNA conjugated to a GalNAc/NAG with a linker would successfully result in at least being endocytosed into a hepatocyte cell and inhibit the target gene and be able to confirm the screen results. Thus, claims 9-12 are obvious.
Response to Arguments
Applicant’s arguments with respect to claims 1-13 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument.

Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).

Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.

If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.

Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.

/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600