Patent Application 17735221 - VESTIBULAR SUPPORTING CELL PROMOTERS AND USES

Title: VESTIBULAR SUPPORTING CELL PROMOTERS AND USES THEREOF
Application Information

Invention Title: VESTIBULAR SUPPORTING CELL PROMOTERS AND USES THEREOF
Application Number: 17735221
Submission Date: 2025-04-10T00:00:00.000Z
Effective Filing Date: 2022-05-03T00:00:00.000Z
Filing Date: 2022-05-03T00:00:00.000Z
National Class: 514
National Sub-Class: 04400R
Examiner Employee Number: 82053
Art Unit: 1638
Tech Center: 1600
Rejection Summary

102 Rejections: 2
103 Rejections: 4
Cited Patents

The following patents were cited in the rejection:
Office Action Text


    Notice of Pre-AIA  or AIA  Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .

Detailed Action
	This action is in response to the papers filed July 12, 2022. 

Amendments
           Applicant's amendments, filed July 12, 2022, is acknowledged. Applicant has cancelled Claims 12 and 14, amended Claims 1-7, 9-10, and 13, and added new claims, Claims 15-19.
Claims 1-11, 13, and 15-19 are pending and under consideration. 
 
Priority
This application is a continuation of PCT/US2020/058795 filed on November 4, 2020. Applicant’s claim for the benefit of a prior-filed application provisional applications 63/024,959 filed on May 14, 2020 and 62/930,520 filed on November 4, 2019 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, or 365(c) is/are acknowledged.  

Information Disclosure Statement
Applicant has filed Information Disclosure Statements on July 31, 2023 and March 13, 2024 that have been considered. 
The signed and initialed PTO Forms 1449 are mailed with this action. 

The Examiner cites below art that is also cited in Applicant’s co-pending application 17/733,744. 
Pursuant to the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.), a copy of the prior cited publication(s) are not provided with the instant Office Action because it is presumed that Applicant has a copy of the prior-cited publication(s), as such is routine practice in the art, and that Applicant has provided their representative with a copy of said publication(s) to establish a prosecution record. However, if Applicant’s representative insists upon receiving a copy of the entire references, then the Examiner will make attempts to provide it in the next Office Action.

Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.

1. 	Claims 1-3 and 9-11 rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more. 
The claim(s) recite(s) a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
With respect to Step 1, the claim is directed to a product, which is a statutory category of invention (Step 1: YES).
With respect to Step 2A, prong one, the judicial exception, the claim is direct to a nucleic acid molecule encoding an SLC6a14 promoter, which is a product of nature or nature-based product, and thus directed to a judicial exception (Step 2A, prong one: YES).
With respect to Step 2A, prong two, the claim does not recite additional elements that integrate the judicial exception into a practical application. While the claims recite the natural product is present in a vector, e.g. a plasmid or rAAV vector, the use of vectors to clone nature-based produce nucleic acid molecules is routine and conventional in the art, and the claimed nature-based SLC6A14 promoter nucleic acid has no different functional characteristics as the natural SLC6A14 promoter. That is to say, mere isolation of the nature-based SLC6A14 promoter nucleic acid, does not add anything significantly more and/or remarkable different, than the natural SLC6A14 promoter. Under the holding of Myriad, this isolated but otherwise unchanged nucleic acid is not eligible because it is not different enough from what exists in nature to avoid improperly tying up the future use and study of naturally occurring SLC6A14 promoter. (Step 2A, prong two: NO).
With respect to Step 2B, the claim is not considered to recite additional elements that amount to significantly more than the judicial exception itself (Step 2B: NO).

2. 	Claims 13 and 17-19 are rejected under 35 U.S.C. 101 because the claimed invention is not supported by either a credible asserted utility or a well-established utility.
The claim(s) recite(s) therapeutic methods of using a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4, e.g. by administering the nucleic acid to a cell or subject.
The claims are considered to lack utility because the nucleic acid vector of Claim 1, from which Claims 13 and 17-19 depend, does not encode a therapeutic transgene operably linked to the SLC6A14 promoter.
The specification fails to disclose any utility or enablement for a polynucleotide that encodes just and SLC6A14 promoter and lacks a transgene operably linked to said promoter.
It would be remedial to amend Claims 13 and 17-19 to require the nucleic acid vector to comprise a transgene operably linked to the SCL6A14 promoter. See, for example, Claim 4.

3. 	Claims 13 and 17-19 are also rejected under 35 U.S.C. 112, first paragraph.
Specifically, since the claimed invention is not supported by either a credible asserted utility or a well-established utility for the reasons set forth above, one skilled in the art clearly would not know how to use the claimed invention.
See further discussion below.

Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.

The following is a quotation of the first paragraph of pre-AIA  35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.

The following is a quotation of 35 U.S.C. 112(b):
(b)  CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.

The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.

4. 	Claim(s) 13 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA  35 U.S.C. 112, the applicant), regards as the invention.
Claim 13 recites the limitation “a transgene” in reference to the vector of Claim 1.  There is insufficient antecedent basis for this limitation in the claim because the nucleic acid vector of Claim 1, from which Claim 13 depends, does not encode a therapeutic transgene operably linked to the SLC6A14 promoter.
It would be remedial to amend Claim 13 to recite the nucleic acid vector to comprise a transgene operably linked to the SCL6A14 promoter. See, for example, Claim 4.

5. 	Claim(s) 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA  35 U.S.C. 112, the applicant), regards as the invention.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, Claim 5 recites the broad recitation “therapeutic protein” and the claim also recites “nuclease”, which is the narrower statement of the range/limitation. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
	The therapeutic protein is recited at a high level of generality, the claims fail to recite, and the specification fails to disclose, a nuclease that is not “therapeutic”, as opposed to a nuclease that is “therapeutic”. 

6. 	Claim(s) 17-19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA  35 U.S.C. 112, the applicant), regards as the invention.
Claim 17 recites a method of treating a subject having or at risk of developing vestibular dysfunction, the method comprising administering to the subject an effective amount of a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
Claim 18 recites a method of inducing or increasing vestibular hair cell regeneration in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
Claim 19 recites a method of treating a subject having bilateral vestibulopathy, the method comprising administering to the subject an effective amount of a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
The claim denotes that there is an amount of the pharmaceutical composition that upon administration to the subject is not, in fact, “a therapeutically effective amount”. 
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
A “therapeutically effective amount” is a functional property that is dependent upon many different variable parameters, including, but not limited to: 
the type of subject [parameter 1] human or non-human animal to be treated; 
the structure/function of the SLC6A14 promoter [parameter 2]; 
the structure/function of the transgene operably linked to the SCL6A14 promoter [parameter 3];
the structure of the genus of nucleic acid vectors [parameter 4]; 
the AAV capsid serotype(s) [parameter 5]; and 
the administration route [parameter 6]; 
the dosage administered [parameter 7]; and 
the phenotypic response to be achieved [parameter 8].
The claim(s) denote(s) that there is an amount of the pharmaceutical composition comprising the nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4, that, upon administration to the subject, is not, in fact, “a therapeutically effective amount” so as to necessarily and predictably: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy in a subject.  

Parameter 1
The claims are broad for reasonably encompassing an enormous genus of animal subjects, including, but not limited to, birds, poultry, chickens, ducks, geese, turkeys, mammals, human, primate, mammals, cattle, pigs, horses, sheep, cats, dogs, rabbits, mice, and rats (e.g pg 13, line 28, “mammal”; pg 28, line 16)
The claims are broad for encompassing about 1,000,000 species of animals (Kingdoms of Life, waynesword.palomar.edu/trfeb98.htm, last visited April 8, 2021), wherein the mammalian sub-genus reasonably encompasses some 6,400 species (including humans), distributed in about 1,200 genera, about 152 families and about 29 orders (Mammal, en.wikipedia.org/wiki/Mammal, last visited August 31, 2022). 

Parameter 2
The claims are broad for reasonably encompassing an enormously vast genus of structurally and functionally undisclosed SLC6A14 promoter variants. 
The SLC6A14 promoter of SEQ ID NO:4 is 834 nucleotides in length. 
85% identity allows for 125 substitutions, deletions, and/or insertions. 
90% identity allows for 83 substitutions, deletions, and/or insertions. 
95% identity allows for 42 substitutions, deletions, and/or insertions. 

4^125 = 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4.
4^83 = 9x10^49 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4.
4^42 = 2x10^42 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4.
(www.calculator.net/exponent-calculator; last visited April 2, 2025)

Parameter 3
The claims are broad for reasonably encompassing an enormously vast genus of structurally and functionally undisclosed transgenes that are to be operably linked to the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants. 
While Claim 1 recites a nucleic acid vector encoding an SLC6A14 promoter, the claim fails to recite the presence of a transgene operably linked to the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants, let alone a transgene that has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy in a subject.  
As evidenced by Claims 5 and 15, the claims encompass an enormously vast genus of structurally and functionally distinct transgene molecules, including siRNAs, antisense oligonucleotides, microRNAs, and proteins. 

Parameter 4
The claims are broad for reasonably encompassing a broad genus of nucleic acid vectors, including plasmids, bacterial artificial chromosomes, yeast artificial chromosomes, cosmids, bacteriophages, transposons, and viruses, such as adenoviruses, AAVs, retroviruses, and lentiviruses (e.g. pg 4, lines 25-26; pg 51, lines 8-10; pgs 51-52, joining para).

Parameter 5
The claims are broad for encompassing an enormous genus of at least 125 different AAV capsid serotype variants, including but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV.rh10, and BAAV (DiPrimio et al (U.S. 2009/0215879; Table 3).

Parameter 6
The claims are broad for encompassing an enormous genus of distinctly different anatomical routes by which the AAV vectors are to be administered to the subject. 
The specification discloses such routes include, but are not limited to, intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, or oral administration (e.g. pg 56, lines 25-27). 
The claimed methods are recited at a high level of generality for the multitude of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic (e.g. High et al (U.S. 2015/0111955, [0077]). 
The Examiner notes that while the specification disclose direct delivery to the inner ear (e.g. Example 12, pg 67, line 29, “administered into the posterior semicircular canal”; Example 11, pg 66, lines 34-35, “injection into the round window membrane”), instant claims fail to recite and require the nucleic acid vector to be delivered to the inner ear, nor that the enormously vast genus of unrecited transgenes be expressed in the cells of the inner ear. 
It would be remedial for Applicant to amend Claims 13 and 17-19 to positively recite the step of administering to the subject’s ear, for example.

Parameter 7
The claimed methods are recited at a high level of generality for failing to recite the nucleic acid vector(s) dosage(s) that is to be administered. 
The specification discloses an enormous range of vector genomes to be administered, e.g. 1x10^6 to 1x10^16 vector genomes (e.g. gs 59-60, joining para). 
The claims would reasonably encompass as little as 1x10^2 to 1x10^20 vector genomes, or more (e.g. Vetter et al (U.S. 2023/0103708, [0152]). 

Parameter 8
The claims are broad for reasonably encompassing an enormous genus of physiologically and phenotypically different results, which evokes the question: A therapeutically effective amount to do what?
For example: 
The specification discloses the “therapeutically effective amount” is sufficient to “effect beneficial or desired results” (e.g. pg 14, line 4), which itself is an arbitrary and subjective determination, and “depends upon the context in which it is being applied” (pg 12, line 10), which itself is variable parameter. 
The specification discloses the therapeutic result includes, but is not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, including prolonging survival (e.g. pg 14, lines 5-15).
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
While pg 7, lines 24-28 discloses an amount sufficient to prevent or reduce vestibular dysfunction, delay the development of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, increase vestibular hair cell numbers, increase vestibular hair cell maturation, increase vestibular hair cell proliferation, increase vestibular hair cell regeneration, increase vestibular hair cell innervation, increase VSC proliferation, or increase VSC numbers, as discussed above, none of Claims 17-19 recite and/or require the nucleic acid vector to be delivered to cells of the inner ear, including vestibular cells and cochlear hair cells, let alone be expressed in said inner ear cells, including vestibular cells and cochlear hair cells. 
If there are multiple phenotypic results by which “therapeutically effective amount” and/or “treating” is determined, yet each yields a different result, then the claim may be indefinite because it is unclear which method is to be performed to determine infringement. 

The claims fail to recite, and the specification fails to disclose, a first nucleic acid pharmaceutical [parameter 4], e.g. bacteriophage, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3] and it’s corresponding dosage [parameter 7] to be administered via a first administration route [parameter 6], e.g. subcutaneously, that is necessarily and predictably able to improve hearing, but does not achieve improved speech discrimination [parameter 8], in a subject [parameter 1], e.g. rabbit, as opposed to a second nucleic acid pharmaceutical [parameter 4], e.g. bacterial artificial chromosome, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3] and it’s corresponding dosage [parameter 7] to be administered via a second administration route [parameter 6], e.g. oral inhalation, that is necessarily and predictably able to achieve some arbitrary and subjective “beneficial therapeutic effects” yet is unable to inhibit or prevent development of vestibular dysfunction in a subject, e.g. monkey, for example.
The claims fail to recite, and the specification fails to disclose, a first nucleic acid pharmaceutical [parameter 4], e.g. plasmid, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3] and it’s corresponding dosage [parameter 7] to be administered via a first administration route [parameter 6], e.g. intramuscularly, that is necessarily and predictably able to slow progression of vestibular dysfunction, but does not achieve increasing vestibular hair cell regeneration [parameter 8], in a subject [parameter 1], e.g. canine, as opposed to a second nucleic acid pharmaceutical [parameter 4], e.g. lentivirus, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3] and it’s corresponding dosage [parameter 7] to be administered via a second administration route [parameter 6], e.g. intravenously, that is necessarily and predictably able to achieve prolonging survival, yet is unable to induce vestibular hair cell regeneration in a subject, e.g. human, for example.
The instant claim as a whole does not apprise one of ordinary skill in the art of its scope and, therefore, does not serve the notice function required by 35 U.S.C. 112, second paragraph, by providing clear warning to others as to what constitutes infringement of the patent.
Appropriate correction is required.

When functional claim language is found indefinite, it typically lacks an adequate written description under §112(a), because an indefinite, unbounded functional limitation would cover a plurality of undisclosed structures and/or method steps of performing a function and indicate that the inventor has not provided sufficient disclosure to show possession of the invention. Thus, in most cases, a §112(b) rejection that is based on functional language having unclear (or no) claim boundaries should be accompanied by a rejection under §112(a) based on failure to provide a written description for the claim. See MPEP 2173.05(g).
	
7. 	Claim(s) 13 and 17-19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. 
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA  35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. 
Claim 13 recites a method of expressing a transgene in a mammalian vestibular supporting cell, the method comprising the step of contacting the mammalian vestibular supporting cell with a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4. The breadth of the claim encompasses VSCs that are in the in vitro context, as well as the in vivo (syn. in a subject) context.
Claim 17 recites a method of treating a subject having or at risk of developing vestibular dysfunction, the method comprising administering to the subject an effective amount of a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
Claim 18 recites a method of inducing or increasing vestibular hair cell regeneration in a subject in need thereof, the method comprising administering to the subject an effective amount of a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
Claim 19 recites a method of treating a subject having bilateral vestibulopathy, the method comprising administering to the subject an effective amount of a nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4.
The claim denotes that there is an amount of the pharmaceutical composition that upon administration to the subject is not, in fact, “a therapeutically effective amount”. 
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
A “therapeutically effective amount” is a functional property that is dependent upon many different variable parameters, including, but not limited to: 
the type of subject [parameter 1] human or non-human animal to be treated; 
the structure/function of the SLC6A14 promoter [parameter 2]; 
the structure/function of the transgene operably linked to the SCL6A14 promoter [parameter 3];
the structure of the genus of nucleic acid vectors [parameter 4]; 
the AAV capsid serotype(s) [parameter 5]; and 
the administration route [parameter 6]; 
the dosage administered [parameter 7]; and 
the phenotypic response to be achieved [parameter 8].
The claim(s) denote(s) that there is an amount of the pharmaceutical composition comprising the nucleic acid vector comprising a SLC6A14 promoter nucleotide sequence having at least 85% identity to, e.g. SEQ ID NO:4, that, upon administration to the subject, is not, in fact, “a therapeutically effective amount” so as to necessarily and predictably: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy in a subject.  

Parameter 1
The claims are broad for reasonably encompassing an enormous genus of animal subjects, including, but not limited to, birds, poultry, chickens, ducks, geese, turkeys, mammals, human, primate, mammals, cattle, pigs, horses, sheep, cats, dogs, rabbits, mice, and rats (e.g pg 13, line 28, “mammal”; pg 28, line 16)
The claims are broad for encompassing about 1,000,000 species of animals (Kingdoms of Life, waynesword.palomar.edu/trfeb98.htm, last visited April 8, 2021), wherein the mammalian sub-genus reasonably encompasses some 6,400 species (including humans), distributed in about 1,200 genera, about 152 families and about 29 orders (Mammal, en.wikipedia.org/wiki/Mammal, last visited August 31, 2022). 

Parameter 2
The claims are broad for reasonably encompassing an enormously vast genus of structurally and functionally undisclosed SLC6A14 promoter variants. 
The SLC6A14 promoter of SEQ ID NO:4 is 834 nucleotides in length. 
85% identity allows for 125 substitutions, deletions, and/or insertions. 
90% identity allows for 83 substitutions, deletions, and/or insertions. 
95% identity allows for 42 substitutions, deletions, and/or insertions. 

4^125 = 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4.
4^83 = 9x10^49 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4.
4^42 = 2x10^42 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4.
(www.calculator.net/exponent-calculator; last visited April 2, 2025)

Parameter 3
The claims are broad for reasonably encompassing an enormously vast genus of structurally and functionally undisclosed transgenes that are to be operably linked to the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants. 
While Claim 1 recites a nucleic acid vector encoding an SLC6A14 promoter, the claim fails to recite the presence of a transgene operably linked to the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants, let alone a transgene that has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy in a subject.  
As evidenced by Claims 5 and 15, the claims encompass an enormously vast genus of structurally and functionally distinct transgene molecules, including siRNAs, antisense oligonucleotides, microRNAs, and proteins. 

Parameter 4
The claims are broad for reasonably encompassing a broad genus of nucleic acid vectors, including plasmids, bacterial artificial chromosomes, yeast artificial chromosomes, cosmids, bacteriophages, transposons, and viruses, such as adenoviruses, AAVs, retroviruses, and lentiviruses (e.g. pg 4, lines 25-26; pg 51, lines 8-10; pgs 51-52, joining para).

Parameter 5
The claims are broad for encompassing an enormous genus of at least 125 different AAV capsid serotype variants, including but not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV.rh10, and BAAV (DiPrimio et al (U.S. 2009/0215879; Table 3).

Parameter 6
The claims are broad for encompassing an enormous genus of distinctly different anatomical routes by which the AAV vectors are to be administered to the subject. 
The specification discloses such routes include, but are not limited to, intravenous, parenteral, intradermal, transdermal, intramuscular, intranasal, subcutaneous, percutaneous, intratracheal, intraperitoneal, intraarterial, intravascular, inhalation, perfusion, lavage, or oral administration (e.g. pg 56, lines 25-27). 
The claimed methods are recited at a high level of generality for the multitude of anatomically distinct administration routes, including, but not limited to, delivery and administration systemically, regionally or locally, or by any route, for example, by injection, infusion, orally, alimentary, ingestion, inhalation, mucosal, respiration, intranasal, intubation, intrapulmonary, intrapulmonary instillation, buccal, sublingual, otopically, transdermally, dermal, intradermal, subcutaneously, parenterally, transmucosally, rectally, intracavity, intraglandular, intra-pleurally, intraperitoneally, intravenously, intrarterial, intravascular, intramuscularly, intracranially, intra-spinal, intrathecal, iontophoretic, intraocular, ophthalmic, optical, intraorgan, or intralymphatic (e.g. High et al (U.S. 2015/0111955, [0077]). 
The Examiner notes that while the specification disclose direct delivery to the inner ear (e.g. Example 12, pg 67, line 29, “administered into the posterior semicircular canal”; Example 11, pg 66, lines 34-35, “injection into the round window membrane”), instant claims fail to recite and require the nucleic acid vector to be delivered to the inner ear, nor that the enormously vast genus of unrecited transgenes be expressed in the cells of the inner ear. 
It would be remedial for Applicant to amend Claims 13 and 17-19 to positively recite the step of administering to the subject’s ear, for example.

Parameter 7
The claimed methods are recited at a high level of generality for failing to recite the nucleic acid vector(s) dosage(s) that is to be administered. 
The specification discloses an enormous range of vector genomes to be administered, e.g. 1x10^6 to 1x10^16 vector genomes (e.g. gs 59-60, joining para). 
The claims would reasonably encompass as little as 1x10^2 to 1x10^20 vector genomes, or more (e.g. Vetter et al (U.S. 2023/0103708, [0152]). 

Parameter 8
The claims are broad for reasonably encompassing an enormous genus of physiologically and phenotypically different results, which evokes the question: A therapeutically effective amount to do what?
For example: 
The specification discloses the “therapeutically effective amount” is sufficient to “effect beneficial or desired results” (e.g. pg 14, line 4), which itself is an arbitrary and subjective determination, and “depends upon the context in which it is being applied” (pg 12, line 10), which itself is variable parameter. 
The specification discloses the therapeutic result includes, but is not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, including prolonging survival (e.g. pg 14, lines 5-15).
A claim may be rendered indefinite by reference to an object that is variable. (MPEP §2173.05(b)).
While pg 7, lines 24-28 discloses an amount sufficient to prevent or reduce vestibular dysfunction, delay the development of vestibular dysfunction, slow the progression of vestibular dysfunction, improve vestibular function, increase vestibular hair cell numbers, increase vestibular hair cell maturation, increase vestibular hair cell proliferation, increase vestibular hair cell regeneration, increase vestibular hair cell innervation, increase VSC proliferation, or increase VSC numbers, as discussed above, none of Claims 17-19 recite and/or require the nucleic acid vector to be delivered to cells of the inner ear, including vestibular cells and cochlear hair cells, let alone be expressed in said inner ear cells, including vestibular cells and cochlear hair cells. 
If there are multiple phenotypic results by which “therapeutically effective amount” and/or “treating” is determined, yet each yields a different result, then the claim may be indefinite because it is unclear which method is to be performed to determine infringement. 

A “representative number of species” means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus. See AbbVie Deutschland GmbH & Co., KG v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014) (Claims directed to a functionally defined genus of antibodies were not supported by a disclosure that “only describe[d] one type of structurally similar antibodies” that “are not representative of the full variety or scope of the genus.”).
Noelle v. Lederman, 355 F.3d 1343, 1350, 69 USPQ2d 1508, 1514 (Fed. Cir. 2004) (Fed. Cir. 2004) (“[A] patentee of a biotechnological invention cannot necessarily claim a genus after only describing a limited number of species because there may be unpredictability in the results obtained from species other than those specifically enumerated.”). “A patentee will not be deemed to have invented species sufficient to constitute the genus by virtue of having disclosed a single species when … the evidence indicates ordinary artisans could not predict the operability in the invention of any species other than the one disclosed.” In re Curtis, 354 F.3d 1347, 1358, 69 USPQ2d 1274, 1282 (Fed. Cir. 2004)
The Federal Circuit has explained that a specification cannot always support expansive claim language and satisfy the requirements of 35 U.S.C. 112 “merely by clearly describing one embodiment of the thing claimed.” LizardTech v. Earth Resource Mapping, Inc., 424 F.3d 1336, 1346, 76 USPQ2d 1731, 1733 (Fed. Cir. 2005). 
	For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are “representative of the full variety or scope of the genus,” or by the establishment of “a reasonable structure-function correlation.” Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014) 

The claims fail to recite, and the specification fails to disclose, a first nucleic acid pharmaceutical [parameter 4], e.g. bacteriophage, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3], e.g. a structurally and functionally undisclosed microRNA and/or is operably linked to a nucleic acid encoding said structurally and functionally undisclosed miRNA, and it’s corresponding dosage [parameter 7] to be administered via a first administration route [parameter 6], e.g. subcutaneously, that is necessarily and predictably able to improve hearing, but does not achieve improved speech discrimination [parameter 8], in a subject [parameter 1], e.g. rabbit, as opposed to a second nucleic acid pharmaceutical [parameter 4], e.g. bacterial artificial chromosome, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3], e.g. a structurally and functionally undisclosed therapeutic protein and/or is operably linked to a transgene encoding said structurally and functionally undisclosed therapeutic protein, and it’s corresponding dosage [parameter 7] to be administered via a second administration route [parameter 6], e.g. oral inhalation, that is necessarily and predictably able to achieve some arbitrary and subjective “beneficial therapeutic effects” yet is unable to inhibit or prevent development of vestibular dysfunction in a subject, e.g. monkey, for example.
The claims fail to recite, and the specification fails to disclose, a first nucleic acid pharmaceutical [parameter 4], e.g. plasmid, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3], e.g. a structurally and functionally undisclosed antisense oligonucleotide and/or is operably linked to a nucleic acid encoding said structurally and functionally undisclosed antisense oligonucleotide and it’s corresponding dosage [parameter 7] to be administered via a first administration route [parameter 6], e.g. intramuscularly, that is necessarily and predictably able to slow progression of vestibular dysfunction, but does not achieve increasing vestibular hair cell regeneration [parameter 8], in a subject [parameter 1], e.g. canine, as opposed to a second nucleic acid pharmaceutical [parameter 4], e.g. lentivirus, encoding the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2] that lacks an enormous genus of structurally and functionally distinct transgenes [parameter 3], e.g. Sall3 and/or a nucleic acid encoding Sall3, and it’s corresponding dosage [parameter 7] to be administered via a second administration route [parameter 6], e.g. intravenously, that is necessarily and predictably able to achieve prolonging survival, yet is unable to induce vestibular hair cell regeneration in a subject, e.g. human, for example.

"The claimed invention as a whole may not be adequately described if the claims require an essential or critical element which is not adequately described in the specification and which is not conventional in the art", "when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus", "in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus''. MPEP §2163

An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations using such descriptive means as words, structures, figures, diagrams, and formulas that fully set forth the claimed invention. Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). 

Possession may also be shown in a variety of ways including description of an actual reduction to practice, or by showing that the invention was ''ready for patenting'' such as by the disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention. See, e.g., Pfaff v. Wells Elecs., Inc., 525 U.S. 55, 68, 1 19 S.Ct. 304, 312, 48 USPQ2d 1641, 1647 (1998), Regents of the University of California v. Eli Lilly, 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1406 (Fed. Cir. 1997)*, Amgen, Inc. v. Chugai Pharmaceutical, 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by ''whatever characteristics sufficiently distinguish it''). 

Therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. See Fiers v. Revel, 25 USPQ2d 1602 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. In Fiddes, claims directed to mammalian FGF's were found to be unpatentable due to lack of written description for that broad class. The specification provided only the bovine sequence.

Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).

Based on the applicant's specification, those of ordinary skill in the art cannot envision the detailed nexus of combinations of: 
the enormous genus of human and non-human animal subjects [parameter 1] to be treated; 
the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2]; 
the enormously vast genus of structurally and functionally undisclosed transgenes operably linked to the SCL6A14 promoter [parameter 3];
the enormous genus of genus of nucleic acid vectors [parameter 4]; 
the enormous genus of AAV capsid serotype(s) [parameter 5]; and 
the enormous genus of anatomically distinct administration routes [parameter 6]; 
the enormous genus of nucleic acid vector dosages to be administered [parameter 7]; and 
the broad genus of different phenotypic responses to be achieved [parameter 8], 
so as to necessarily and predictably: 
has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy, including, but not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, prolonging survival, preventing or reducing vestibular dysfunction, delaying the development of vestibular dysfunction, slowing the progression of vestibular dysfunction, improving vestibular function, increasing vestibular hair cell numbers, increasing vestibular hair cell maturation, increasing vestibular hair cell proliferation, increasing vestibular hair cell regeneration, increasing vestibular hair cell innervation, increasing VSC proliferation, or increasing VSC numbers. 

At best, the specification discloses the use of AAV serotype 8, whereby said AAV8 vector encodes the SLC6A14 promoter of SEQ ID NO:4 operably linked to the Atoh1 cDNA of nucleotides 1083-2144 of SEQ ID NO:7, administered to the ear via injection through the round window at a dose of 7x10^9 vector genomes/ear, of a mouse subject suffering from damaged or killed inner ear hair cells (e.g. Example 12).
	
In Amgen, Inc., v. Sanofi (872 F.3d 1367 (2017)
At 1375, [T]he use of post-priority-date evidence to show that a patent does not disclose a representative number of species of a claimed genus is proper. 
At 1377, [W]e questioned the propriety of the "newly characterized antigen" test and concluded that instead of "analogizing the antibody-antigen relationship to a `key in a lock,'" it was more apt to analogize it to a lock and "a ring with a million keys on it." Id. at 1352.
	An adequate written description must contain enough information about the actual makeup of the claimed products — "a precise definition, such as by structure, formula, chemical name, physical properties, or other properties, of species falling within the genus sufficient to distinguish the genus from other materials," which may be present in "functional" terminology "when the art has established a correlation between structure and function." Ariad, 598 F.3d at 1350. But both in this case and in our previous cases, it has been, at the least, hotly disputed that knowledge of the chemical structure of an antigen gives the required kind of structure-identifying information about the corresponding antibodies. See, e.g., J.A. 1241 (549:5-
16) (Appellants' expert Dr. Eck testifying that knowing "that an antibody binds to a particular amino acid on PCSK9 ... does not tell you anything at all about the structure of the antibody"); J.A. 1314 (836:9-11) (Appellees' expert Dr. Petsko being informed of Dr. Eck's testimony and responding that "[m]y opinion is that [he's] right"); Centocor, 636 F.3d at 1352 (analogizing the antibody-antigen relationship as searching for a key "on a ring with a million keys on it") (internal citations and quotation marks omitted).
	In the instant case, the breadth of the claims reasonably encompasses: 
an enormous genus of human and non-human animal subjects [parameter 1] to be treated; 
an enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2]; 
an enormously vast genus of structurally and functionally undisclosed transgenes operably linked to the SCL6A14 promoter [parameter 3];
an enormous genus of genus of nucleic acid vectors [parameter 4]; 
an enormous genus of AAV capsid serotype(s) [parameter 5]; and 
an enormous genus of anatomically distinct administration routes [parameter 6]; 
an enormous genus of nucleic acid vector dosages to be administered [parameter 7]; and 
a broad genus of different phenotypic responses to be achieved [parameter 8].

The claim(s) denote(s) that there is an amount of the pharmaceutical composition comprising the nucleic acid vectors that, upon administration to the subject, is not, in fact, “a therapeutically effective amount” so as to necessarily and predictably: 
has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy, including, but not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, prolonging survival, preventing or reducing vestibular dysfunction, delaying the development of vestibular dysfunction, slowing the progression of vestibular dysfunction, improving vestibular function, increasing vestibular hair cell numbers, increasing vestibular hair cell maturation, increasing vestibular hair cell proliferation, increasing vestibular hair cell regeneration, increasing vestibular hair cell innervation, increasing VSC proliferation, or increasing VSC numbers. 
As discussed above, none of Claims 13 and 17-19 recite and/or require the nucleic acid vector to be delivered to cells of the inner ear, including vestibular cells and cochlear hair cells, let alone be expressed in said inner ear cells, including vestibular cells and cochlear hair cells. 

In Amgen, Inc., v. Sanofi (U.S. Supreme Court, No. 21-757 (2023))
“Amgen seeks to monopolize an entire class of things defined by their function”. 
In the instant case, Applicant seeks to monopolize an entire class of treating vestibular dysfunction in an enormous genus of animal subjects without satisfying the real-world scientific and clinical nexus of: 
an enormous genus of human and non-human animal subjects [parameter 1] to be treated; 
an enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2]; 
an enormously vast genus of structurally and functionally undisclosed transgenes operably linked to the SCL6A14 promoter [parameter 3];
an enormous genus of genus of nucleic acid vectors [parameter 4]; 
an enormous genus of AAV capsid serotype(s) [parameter 5]; and 
an enormous genus of anatomically distinct administration routes [parameter 6]; 
an enormous genus of nucleic acid vector dosages to be administered [parameter 7]; and 
a broad genus of different phenotypic responses to be achieved [parameter 8], so as to necessarily and predictably: 
has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy, including, but not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, prolonging survival, preventing or reducing vestibular dysfunction, delaying the development of vestibular dysfunction, slowing the progression of vestibular dysfunction, improving vestibular function, increasing vestibular hair cell numbers, increasing vestibular hair cell maturation, increasing vestibular hair cell proliferation, increasing vestibular hair cell regeneration, increasing vestibular hair cell innervation, increasing VSC proliferation, or increasing VSC numbers. 

“It freely admits that it seeks to claim for itself an entire universe of antibodies.”
“They leave a scientist forced to engage in painstaking experimentation to see what works. 159 U.S., at 475. 
This is not enablement. More nearly, it is “a hunting license”. Brenner v. Manson, 383 U.S. 519, 536 (1966). 
“Amgen has failed to enable all that it has claimed, even allowing for a reasonable degree of experimentation”. 
While the “roadmap” would produce functional combinations, it would not enable others to make and use the functional combinations; it would instead leave them to “random trial-and-error discovery”. 
	“Amgen offers persons skilled in the art little more than advice to engage in “trial and error”. 
	“The more a party claims for itself the more it must enable.”
	“Section 112 of the Patent Act reflects Congress’s judg-ment that if an inventor claims a lot, but enables only a lit-tle, the public does not receive its benefit of the bargain. For more than 150 years, this Court has enforced the stat-utory enablement requirement according to its terms. If the Court had not done so in Incandescent Lamp, it might have been writing decisions like Holland Furniture in the dark. Today’s case may involve a new technology, but the legal principle is the same. 

Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph. 
See further discussion below in the 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, enablement rejection.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA  35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)

8. 	Claims 13 and 17-19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, while being enabling for a method of treating a mouse subject suffering from damaged or killed inner ear cells, the method comprising the step of administered to the ear via injection through the round window at a dose of 7x10^9 vector genomes/ear of said mouse subject an AAV serotype 8 virus whose genome encodes the SLC6A14 promoter of SEQ ID NO:4 operably linked to the Atoh1 cDNA of nucleotides 1083-2144 of SEQ ID NO:7, 
does not reasonably provide enablement for the real-world nexus between:
the enormous genus of human and non-human animal subjects [parameter 1] to be treated; 
the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2]; 
the enormously vast genus of structurally and functionally undisclosed transgenes operably linked to the SCL6A14 promoter [parameter 3];
the enormous genus of genus of nucleic acid vectors [parameter 4]; 
the enormous genus of AAV capsid serotype(s) [parameter 5]; and 
the enormous genus of anatomically distinct administration routes [parameter 6]; 
the enormous genus of nucleic acid vector dosages to be administered [parameter 7]; and 
the broad genus of different phenotypic responses to be achieved [parameter 8], 
so as to necessarily and predictably: 
has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy, including, but not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, prolonging survival, preventing or reducing vestibular dysfunction, delaying the development of vestibular dysfunction, slowing the progression of vestibular dysfunction, improving vestibular function, increasing vestibular hair cell numbers, increasing vestibular hair cell maturation, increasing vestibular hair cell proliferation, increasing vestibular hair cell regeneration, increasing vestibular hair cell innervation, increasing VSC proliferation, or increasing VSC numbers. 

The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
	While determining whether a specification is enabling, one considers whether the claimed invention provides sufficient guidance to make and use the claimed invention. If not, whether an artisan would have required undue experimentation to make and use the claimed invention and whether working examples have been provided. When determining whether a specification meets the enablement requirements, some of the factors that need to be analyzed are: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and whether the quantity of any necessary experimentation to make or use the invention based on the content of the disclosure is “undue” (In re Wands, 858 F.2d 731, 737, 8 USPQ2ds 1400, 1404 (Fed. Cir. 1988)). Furthermore, USPTO does not have laboratory facilities to test if an invention will function as claimed when working examples are not disclosed in the specification. Therefore, enablement issues are raised and discussed based on the state of knowledge pertinent to an art at the time of the invention. And thus, skepticism raised in the enablement rejections are those raised in the art by artisans of expertise. 
The Examiner incorporates herein the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, written description rejection.

The nature of the invention involves one of the most complex and unpredictable areas of medicine molecular biology - gene therapy treatment. 
The invention is in a class of invention which the CAFC has characterized as "the unpredictable arts such as chemistry and biology." Mycogen Plant Sci., Inc. v. Monsanto Co., 243 F.3d 1316, 1330 (Fed. Cir. 2001). 

The State of the Prior Art, The Level of One of Ordinary Skill and The Level of Predictability in the Art
	Considering the mode of administration, the specification simply requires administration of the AAV to the subject by any means. The art has demonstrated through numerous publications, delivery of nucleic acid vectors in vivo is highly unpredictable for successful human therapy.  
	At issue in general are organ barriers, failure to persist, side-effects in other organs, T-cell responses, virus neutralizing antibodies, humoral immunity, normal tropism of the vector to other organs and more. The challenge is to maintain the efficiency of delivery and expression while minimizing any pathogenicity of the virus from which the vector was derived. The inability to develop an adequate means of overcoming obstacles such as humoral; responses and refractory cells limits the successful means by which the nucleic acid can be administered. The physiological art is recognized as unpredictable. (MPEP 2164.03.) In cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws. In cases involving unpredictable factors, such as most chemical reactions and physiological activity, the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved. In this case, the nucleic acid is broadly stated as being administered to a patient. The lack of guidance exacerbates the highly unpredictable field of gene therapy and the method of delivery of polynucleotides is highly unpredictable to date. Gene delivery has been a persistent problem for gene therapy protocols and the route of delivery itself presents an obstacle to be overcome for the application of the vector therapeutically. 
	Fumoto et al (Targeted Gene Delivery: Importance of Administration Routes, INTECH, Novel Gene Therapy Approaches, pg 3-31; editors Wei and Good, publisher Books on Demand, 2013) details these obstacles wherein direct injection is to date the best procedure (pg 11, Table 3, Figure 3, “Direct injection of rAAV vector…exhibited faster and stronger transgene expression than intravenous and intraportal injections”). 
	To date, no single mode of gene transfer has provided a viable option for successful gene therapy protocols Daya et al (Gene Therapy Using Adeno-Associated Virus Vectors, Clin. Microbiol. Rev. 21(4): 583-593, 2008; pg 590-591, joining ¶). When considering AAV therapy, there are many obstacles to its use systemically- host cell immune response which leads to toxicity (Daya et al, pg 587, col 2), blood brain as well as cellular barriers against the virus, adequate expression, degradation of the vector or the product. Even the use of targeting methods and tissue specific promoters have done little to overcome the numerous obstacles related to gene delivery. Even use of tissue specific promoters and capsids targeting has not successfully overcome these obstacles. Taken together with the large breadth of target tissues and diseases claimed, in light of the difficulties to overcome even one of these barriers, one could not perform the full breadth of the claims. 
Huang et al (Genetic Manipulation of Brown Fat Via Oral Administration of an Engineered Recombinant Adeno-associated Viral Serotype Vector, Molecular Therapy 24(6): 1062-1069, 2016) is considered relevant prior art for having taught oral administration of rAAV, whereupon transgene expression was not detected in heart, stomach, intestine, skeletal muscle, kidney, spleen, lung, nor brain (e.g. pg 1062, col. 2; Figure 2). 
Tian et al (Aerosol Inhalation-mediated Delivery of an Adeno-associated Virus 5-expressed Antagonistic Interleukin-4 Mutant Ameliorates Experimental Murine Asthma, Archives of Medical Research 50: 384-392, 2019) is considered relevant art for having taught inhaled administration of rAAV, whereupon AAV vector DNA was detected in the lung, but not detected in other organs, such as heart, liver, kidney, brain, lymph nodes, and gonads (e.g. Abstract; pg 386, col. 2). 
Ghoraba et al (Ocular Gene Therapy: A Literature Review with Special Focus on Immune and Inflammatory Responses, Clinical Opthalmology 16: 1753-1771, 2022) is considered relevant post-filing art for having taught that the associated immune and inflammatory reactions to gene therapy, including rAAV-based gene therapies, may render such treatment ineffective or harmful, which are of particular concerns for the eyes due to their susceptibility to inflammation. The route of administration directly impacts the degree of immune and inflammatory reaction. Several instances of vision loss due to severe late onset intraocular inflammation were reported in a clinical trial involving intravitreal delivery of viral vectors (Abstract). Intravitreal administration, while convenient, is unable to transduce the outer retina layers, which is the main target of most retinal diseases due to defects in the RPE or photoreceptor cells (e.g. pg 1762, Intravitreal Delivery). Studies on humans and NHPs have demonstrated consistently that intravitreal delivery of vectors induces a significant humoral immune response. The response is marked by the production of Abs, which may not lead to inflammation, but can significantly reduce the efficacy of treatment by attacking and eliminating transduced cells through the neutralizing antibodies (pg 1763, para 1). 
Acland et al (U.S. 2004/0022766) is considered relevant prior art for having disclosed a recombinant adeno-associated virus (rAAV), said rAAV comprising an AAV capsid [0023], and a vector genome packaged therein, said vector genome comprising:
(a) an AAV 5' inverted terminal repeat (ITR) sequence;
(b) a promoter;
(c) a coding sequence encoding a human Lebercilin [0031]. 
Acland et al disclosed [0057] “[T]he use of subretinal injection as the route of delivery is a critical component of this method, as intravitreal administration does not enable the same therapeutic effects. The vector and carrier cannot diffuse across the multiple cell layers in the retina to reach the RPE, when intravitreal injection is used. Similarly, intravenous delivery is unacceptable because the material does not penetrate the blood-brain (blood-retina) barrier. Because the virus does not diffuse well, topical administration is similarly not preferred for this method.”

Reliance on animal models is not predictive of clinical outcome. This has been complicated by the inability to extrapolate delivery methods in animals with those in humans or higher animals. 
Mingozzi and High (Immune responses to AAV vectors: overcoming barriers to successful gene therapy, Blood 122(1): 23-36, 2013) demonstrate that the human findings are not recapitulated from the animal studies (page 26, col 2, “it seemed logical that one could model the human immune response in these animals, but multiple attempts to do so have also failed”). Hence, lessons learned from small animals such as the mice studies could not recapitulate the ability to deliver adequately in humans. 
Kattenhorn et al (Adeno-Associated Virus Gene Therapy for Liver Disease, Human Gene Therapy 27(12): 947-961, November 28, 2016) taught concerns for translation lead to extensive analysis of the effects on clinical use. The use of AAV after initial promising results went on hiatus (pg 947, col. 2, “clinical hiatus in the field”) as the animal models were deficient (pg 953, col. 2, “Although animal models predicted many aspects of the human immune response…, they largely failed to predict responses to AAV capsid”; “Work done in nonhuman primates has not met with any additional success”). This emphasizes that the challenge in humans is to maintain the efficiency of delivery and expression while minimizing any pathogenicity of the virus from which the vector was derived. Eventually, the use of AAV is serotype-dependent (e.g. pg 950, col. 1), organ and concentration dependent. The inability to develop an adequate means of overcoming humoral responses, neutralizing antibody, inactivation of transgene expression, shedding and refractory cells limits the successful means by which the nucleic acid can be administered. 
Ferdowsian et al (Primates in Medical Research: A Matter of Convenience, not Sound Science, The Hastings Center, www.thehastingscenter.org/primates-in-medical-research-convenience-not-sound-science/; July 8, 2022; last visited September 27, 2024) is considered relevant art for having taught that, “Today, unlike in the 17th century, scientists easily recognize the truth in the saying “mice lie and monkeys exaggerate,” which points to a well-known problem in biomedical research: using nonhuman primates and other animals in research fails more often than it succeeds.”

The gene therapy art is unpredictable, as manifested in the poor and unpredictable targeting of the gene therapy vectors to target cells, routes of administration, the transient and unpredictable expression of the transgenes in target cells, the specific genes to be used for a treatment, the unsuitability of many animal models of human diseases, etc…, all critical for the success of a gene therapy method. 
Based on the applicant's specification, those of ordinary skill in the art cannot envision the detailed nexus of combinations of: 
the enormous genus of human and non-human animal subjects [parameter 1] to be treated; 
the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2]; 
the enormously vast genus of structurally and functionally undisclosed transgenes operably linked to the SCL6A14 promoter [parameter 3];
the enormous genus of genus of nucleic acid vectors [parameter 4]; 
the enormous genus of AAV capsid serotype(s) [parameter 5]; and 
the enormous genus of anatomically distinct administration routes [parameter 6]; 
the enormous genus of nucleic acid vector dosages to be administered [parameter 7]; and 
the broad genus of different phenotypic responses to be achieved [parameter 8], 
so as to necessarily and predictably: 
has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy, including, but not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, prolonging survival, preventing or reducing vestibular dysfunction, delaying the development of vestibular dysfunction, slowing the progression of vestibular dysfunction, improving vestibular function, increasing vestibular hair cell numbers, increasing vestibular hair cell maturation, increasing vestibular hair cell proliferation, increasing vestibular hair cell regeneration, increasing vestibular hair cell innervation, increasing VSC proliferation, or increasing VSC numbers. 

At best, the specification discloses the use of AAV serotype 8, whereby said AAV8 vector encodes the SLC6A14 promoter of SEQ ID NO:4 operably linked to the Atoh1 cDNA of nucleotides 1083-2144 of SEQ ID NO:7, administered to the ear via injection through the round window at a dose of 7x10^9 vector genomes/ear, of a mouse subject suffering from damaged or killed inner ear hair cells (e.g. Example 12).

The specification fails to make up for deficiencies of the global scientific community, and thus the ordinary artisans must determine for themselves that which Applicant fails to disclose. 

The Quantity of Any Necessary Experimentation to Make or Use the Invention
Thus, the quantity of necessary experimentation to make or use the invention as claimed, based upon what is known in the art and what has been disclosed in the specification, will create an undue burden for a person of ordinary skill in the art to demonstrate make and use the detailed nexus of combinations of: 
the enormous genus of human and non-human animal subjects [parameter 1] to be treated; 
the enormously vast genus of about 2x10^75 structurally and functionally undisclosed SLC6A14 promoter variants of SEQ ID NO:4 [parameter 2]; 
the enormously vast genus of structurally and functionally undisclosed transgenes operably linked to the SCL6A14 promoter [parameter 3];
the enormous genus of genus of nucleic acid vectors [parameter 4]; 
the enormous genus of AAV capsid serotype(s) [parameter 5]; and 
the enormous genus of anatomically distinct administration routes [parameter 6]; 
the enormous genus of nucleic acid vector dosages to be administered [parameter 7]; and 
the broad genus of different phenotypic responses to be achieved [parameter 8], 
so as to necessarily and predictably: 
has the functional properties of: 
treating a subject having vestibular dysfunction; 
treating a subject at risk of developing vestibular dysfunction; 
inducing vestibular hair cell regeneration in a subject; 
increasing vestibular hair cell regeneration in a subject; and/or
treating bilateral vestibulopathy, including, but not limited to, alleviation or amelioration of one or more symptoms or conditions; diminishment of extent of disease or condition; stabilized (i.e., not worsening) state of disease, disorder, or condition; preventing spread of disease or condition; delay or slowing the progress of the disease or condition; amelioration or palliation of the disease or condition; and remission (whether partial or total), whether detectable or undetectable, whereby "ameliorating" or "palliating" a disease or condition means that the extent and/or undesirable clinical manifestations of the disease, disorder, or condition are lessened and/or time course of the progression is slowed or lengthened, as compared to the extent or time course in the absence of treatment, prolonging survival, preventing or reducing vestibular dysfunction, delaying the development of vestibular dysfunction, slowing the progression of vestibular dysfunction, improving vestibular function, increasing vestibular hair cell numbers, increasing vestibular hair cell maturation, increasing vestibular hair cell proliferation, increasing vestibular hair cell regeneration, increasing vestibular hair cell innervation, increasing VSC proliferation, or increasing VSC numbers. 
It is generally recognized in the art that biological compounds often react unpredictably under different circumstances (Nationwide Chem. Corp. v. Wright, 458 F. supp. 828, 839, 192 USPQ95, 105(M.D. Fla. 1976); Affd 584 F.2d 714, 200 USPQ257 (5th Cir. 1978); In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970)). The relative skill of the artisan and the unpredictability of the pharmaceutical art are very high. Where the physiological activity of a chemical or biological compound is considered to be an unpredictable art (Note that in cases involving physiological activity such as the instant case, "the scope of enablement obviously varies inversely with the degree of unpredictability of the factors involved" (See In re Fischer, 427 F.2d 833, 839, 166 USPQ 10, 24(CCPA 1970))), the skilled artisan would have not known how to extrapolate the results provided in the instant specification of administering directly to the cochlear inner ear cells the AAV2 vectors encoding OTOF-5 to the larger genus of AAV capsid serotypes having different cellular tropisms, the enormous genus of anatomically different administration routes, and the enormous genus of rAAV dosages reasonably encompassed by the claims. Neither the specification nor the claims provide the appropriate nucleic acid vector or viral dosage to be administered in the plurality of possible intravenous, intracranial, intraperitoneal, intramuscular, subcutaneous, intramuscular, intrarectal, intravaginal, intrathecal, intratracheal, intradermal, or transdermal injection, by oral or nasal administration means that would reasonably be expected by the ordinary artisan to necessarily and predictably achieve a clinically meaningful, real-world therapeutic result of treating, prohibiting, and/or preventing sensorineural hearing loss or auditory neuropathy in the enormous genus of animal subjects. 
The gene therapy art is extremely unpredictable. The unpredictability is manifested in the poor and unpredictable targeting of the gene therapy vectors to target cells (the enormous genus of possible AAV serotypes disclosed), routes of administration (as disclosed, do not even require direct administration to the cochlea inner ear cells), the transient and unpredictable expression of the transgenes in target cells (the genus of disclosed possible promoters and/or regulatory sequences), and the unsuitability of many animal models of human diseases, etc…, all critical for the success of a gene therapy method. 
The courts have stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in patent application. 27 USPQ2d 1662 Exparte Maizel. In the instant case, in view of the lack of guidance, working examples, breadth of the claims, the level of skill in the art and state of the art at the time of the claimed invention was made, it would have required undue experimentation to make and/or use the invention as claimed. 
If little is known in the prior art about the nature of the invention and the art is unpredictable, the specification would need more detail as to how to make and use the invention in order to be enabling. See, e.g., Chiron Corp. v. Genentech Inc., 363 F.3d 1247, 1254, 70 USPQ2d 1321, 1326 (Fed. Cir. 2004) ("Nascent technology, however, must be enabled with a 'specific and useful teaching.' The law requires an enabling disclosure for nascent technology because a person of ordinary skill in the art has little or no knowledge independent from the patentee's instruction. Thus, the public's end of the bargain struck by the patent system is a full enabling disclosure of the claimed technology." (citations omitted)).
As In re Gardner, Roe and Willey, 427 F.2d 786,789 (C.C.P.A. 1970), the skilled artisan might eventually find out how to use the invention after “a great deal of work”. In the case of In re Gardner, Roe and Willey, the invention was a compound which the inventor claimed to have antidepressant activity, but was not enabled because the inventor failed to disclose how to use the invention based on insufficient disclosure of effective drug dosage.  The court held that “the law requires that the disclosure in the application shall inform them how to use, not how to find out how to use for themselves”. 
Perrin (Make Mouse Studies Work, Nature (507): 423-425, 2014) taught that the series of clinical trials for a potential therapy can cost hundreds of millions of dollars. The human costs are even greater (pg 423, col. 1). For example, while 12 clinical trials were tested for the treatment of ALS, all but one failed in the clinic (pg 423, col. 2). Experiments necessary in preclinical animal models to characterize new drugs or therapeutic compounds are expensive, time-consuming, and will not, in themselves, lead to new treatments. But without this upfront investment, financial resources for clinical trials are being wasted and [human] lives are being lost (pg 424, col. 1). Animal models are highly variable, and require a large number of animals per test group. Before assessing a drug’s efficacy, researchers should investigate what dose animals can tolerate, whether the drug reaches the relevant tissue at the required dose and how quickly the drug is metabolized or degraded by the body. We estimate that it takes about $30,000 and 6–9 months to characterize the toxicity of a molecule and assess whether enough reaches the relevant tissue and has a sufficient half-life at the target to be potentially effective. If those results are promising, then experiments to test whether a drug can extend an animal’s survival are warranted — this will cost about $100,000 per dose and take around 12 months. At least three doses of the molecule should be tested; this will help to establish that any drug responses are real and suggest what a reasonable dosing level might be. Thus, even assuming the model has been adequately characterized, an investment of $330,000 is necessary just to determine whether a single drug has reasonable potential to treat disease in humans. It could take thousands of patients, several years and hundreds of millions of dollars to move a drug through the clinical development process. The investment required in time and funds is far beyond what any one lab should be expected to do. (pg 425, col.s 2-3). The human costs are even greater: patients with progressive terminal illnesses may have just one shot at an unproven but promising treatment. Clinical trials typically require patients to commit to year or more of treatment, during which they are precluded from pursuing other experimental options (pg 423, col.2 1-3).
Those of ordinary skill in the art would immediately recognize that the instant specification fails to establish the nexus between the broad genus of AAV vectors, the enormous genus of AAV vector dosages, and the corresponding enormous genus of anatomically distinct administration routes so as to necessarily and predictably achieve a real-world, clinically meaningful therapeutic result in the enormous genus of human and non-human animal subjects encompassed by the claimed methods.
Greenberg (Gene Therapy for heart failure, Trends in Cardiovascular Medicine 27: 216-222, 2017) is considered relevant prior art for taught that despite success in experimental animal models, translating gene transfer strategies from the laboratory to the clinic remains at an early stage (Abstract). The success of gene therapy depends on a variety of factors that will ultimately determine the level of transgene expression within the targeted cells. These factors include the vector used for delivery, the method and conditions of delivery of the vector to the [target tissue], the dose that is given and interactions between the host and the vector that alter the efficiency of transfection of [target] cells (e.g. pg 217, col. 1). Failure of therapeutic results may arise because the vector DNA levels were at the lower end of the threshold for dose-response curves in pharmacology studies, and/or only a small proportion of target cells were expressing the therapeutic transgene (e.g. pg 220, col. 1). Although the use of AAVs for gene therapy is appealing, additional information about the best strain of AAVs to use in human patients is needed. Experience indicates that there is a need to carefully consider the dose of the gene therapy vector; however, this has proved to be difficult in early phase developmental studies due to the complexity and cost of such studies (e.g. pg 221, col. 1). 
Maguire et al (Viral vectors for gene delivery to the inner ear, Hearing Research 394: e107927, 13 pages, doi.org/10.1016/j.heares.2020.107927, 2020) is considered relevant post-filing art for taught that despite the progress with AAV vectors in the inner ear, little is known regarding the mechanism of transduction of specific cells by AAV within the cochlea (e.g. pg 2, col. 2). There are limitations to what experiments in mice can tell us about the true translation potential of a new therapeutic (e.g. pg 8, col. 2), e.g. species-related physiological differences between mice and humans (e.g. pg 9, col. 1). The AAV dosage is a significant factor in achieving transduction of the target cell, as insufficient dosage may achieve no transduction of the target cells (e.g. pg 9, col. 2). 
Tobias (Mouse Study Used in Research, Multiple Sclerosis News Today, multiplesclerosisnewstoday.com/news-posts/2023/09/08/lets-not-get-overexcited-about-any-mice-study-used-research/; September 8, 2023; last visited September 27, 2024) is considered relevant art for having taught that, “Mice exaggerate and monkeys lie, some researchers jokingly say. (Or is it the other way around?)” The odds of an experimental treatment making it from mouse or monkey to human are very low. Less than 8% of cancer treatments make it from animal studies into a clinical setting, where they’re tested on people, and only 10% of the medications in those clinical trials make it through to government approval. No wonder some researchers joke about mice and monkeys lying and exaggerating.

The specification fails to make up for the deficiencies of the global scientific community.

Accordingly, limiting the claims to a method of treating a mouse subject suffering from damaged or killed inner ear cells, the method comprising the step of administered to the ear via injection through the round window at a dose of 7x10^9 vector genomes/ear of said mouse subject an AAV serotype 8 virus whose genome encodes the SLC6A14 promoter of SEQ ID NO:4 operably linked to the Atoh1 cDNA of nucleotides 1083-2144 of SEQ ID NO:7, is proper.

Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA  35 U.S.C. 102 and 103 (or as subject to pre-AIA  35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA  to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.  
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.

9. 	Claim(s) 1, 4, and 9-10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Trinklein et al (U.S. 2007/0161031).
With respect to Claim 1, Trinklein et al is considered relevant prior art for having disclosed a promoter library, wherein said promoter library comprises a promoter (SEQ ID NO:44366; 2300nts) that is 99.6% identical (2 mismatches) to instant SEQ ID NO:4.
	With respect to Claim 4, Trinklein et al disclosed wherein the promoter is operably linked to a transgene, e.g. a luciferase cDNA (e.g. Figure 3a).
	With respect to Claim 9, Trinklein et al disclosed wherein the nucleic acid vector is a plasmid (e.g. Figure 10A, “purify plasmid DNAs”; 11A, “array plasmid DNAs”).
	With respect to Claim 10, Trinklein et al disclosed wherein the nucleic acid vector is a plasmid or a viral vector, including an AAV vector (e.g. [0132-133]).
	Thus, Trinklein et al anticipate the claims. 

10. 	Claim(s) 1, 4, and 9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Karunakaran et al (SLC6A14 (ATB0,+) Protein, a Highly Concentrative and Broad Specific Amino Acid Transporter, Is a Novel and Effective Drug Target for Treatment of Estrogen Receptor-positive Breast Cancer, J. Biol. Chem. 286(36): 31830-31838, 2011), as evidenced by GenBank NG_021305.2 (Homo sapiens SLC6A14 gene, September 25, 2018). 
	With respect to Claim 1, Karunkaran et al is considered relevant prior art for having taught a nucleic acid vector comprising a nucleotide sequence encoding a human SLC6A14 promoter. 
	Karunakaran et al taught the use of two primers to amplify/isolate the human SLC6A14 promoter (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
	As evidenced by GenBank NB_021305.2, the human SLC6A14 promoter isolated by Karunakaran et al (upper line) is overall 94% identical to instant SEQ ID NO:4, and comprises a nucleotide sequence that is 100% identical to nucleotides 1-786 of instant SEQ ID NO:4 (lower line), as shown below: 
1585 AAGCTGGGATGTTTCCTCATAGTTTACTTTCTAGGCCTCATCTTTCTTACAGAGTGTGCT 1644
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
   1 AAGCTGGGATGTTTCCTCATAGTTTACTTTCTAGGCCTCATCTTTCTTACAGAGTGTGCT 60

1645 CCTTTGTTAAGGTTAGAATTTCCCATAAACCTGCTCAATAATTTGTTTGTGTTTGGCTTC 1704
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
  61 CCTTTGTTAAGGTTAGAATTTCCCATAAACCTGCTCAATAATTTGTTTGTGTTTGGCTTC 120

1705 TTTGAAATACTACACAAAGCAATCCCTGTAAAAGGCAAAGCTGTCCTGAAGGCTGAGAAA 1764
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 121 TTTGAAATACTACACAAAGCAATCCCTGTAAAAGGCAAAGCTGTCCTGAAGGCTGAGAAA 180

1765 GGAGCCTGAGACATAGGCTCCAAGTTGCTCTTTTCAGGCAGAGCCAGCTGGGTAATCTTA 1824
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 181 GGAGCCTGAGACATAGGCTCCAAGTTGCTCTTTTCAGGCAGAGCCAGCTGGGTAATCTTA 240


1825 TCTCAGATGGCTGCTTTTCAAGGTGCCCAATTCAGGGGCTTTTCCTCTGGGAGCAGCATT 1884
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 241 TCTCAGATGGCTGCTTTTCAAGGTGCCCAATTCAGGGGCTTTTCCTCTGGGAGCAGCATT 300

1885 TGCCCCAGGGAATCAAGTGCTTTCTAGTCAGGGGCAAAACTTTGGGAAATCTGAGGACCC 1944
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 301 TGCCCCAGGGAATCAAGTGCTTTCTAGTCAGGGGCAAAACTTTGGGAAATCTGAGGACCC 360

1945 AGGGTGGTATGGTCTGTTCAGGAGAATTTTGGGGAACAGAATGGCCCCCTTCTCCCTCCA 2004
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 361 AGGGTGGTATGGTCTGTTCAGGAGAATTTTGGGGAACAGAATGGCCCCCTTCTCCCTCCA 420

2005 GCACTTGTACAGATCAGCACTTGGCCCCAGAACAGAGACCAGACTGAGAGGCGAGGTTAG 2064
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 421 GCACTTGTACAGATCAGCACTTGGCCCCAGAACAGAGACCAGACTGAGAGGCGAGGTTAG 480

2065 GAGGAAACAGGGGACCCAGGAAAGGCGGCTAGATTGCAAACGTACCTACACAGCTCTGAG 2124
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 481 GAGGAAACAGGGGACCCAGGAAAGGCGGCTAGATTGCAAACGTACCTACACAGCTCTGAG 540

2125 TCAAAGGCTGTCAGTCATCTCGGCTCAGACTGCTCTGCTCTCCAGCAGCCCAGCCCTTTC 2184
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 541 TCAAAGGCTGTCAGTCATCTCGGCTCAGACTGCTCTGCTCTCCAGCAGCCCAGCCCTTTC 600

2185 CCAGGGCTGGGGCAGGAGATTGCTACATGTAGGCTTATCTGGGGAAAAACCAGAGCCTCA 2244
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 601 CCAGGGCTGGGGCAGGAGATTGCTACATGTAGGCTTATCTGGGGAAAAACCAGAGCCTCA 660

2245 CTTTAGTCCCTTCCGGTAATTGACACTACTGGACACCCAGGAGGGGGAGGAGAGAGCTTC 2304
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 661 CTTTAGTCCCTTCCGGTAATTGACACTACTGGACACCCAGGAGGGGGAGGAGAGAGCTTC 720

2305 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 2364
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 721 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 780

2365 AGAGTG 2370
     ||||||
 781 AGAGTG 786
	With respect to Claim 4, Karunkaran et al taught wherein the SLC6A14 promoter is operably linked to a transgene, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
	With respect to Claim 9, Karunkaran et al taught wherein the nucleic acid vector is a plasmid (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
	Thus, Karunkaran et al anticipate the claims. 



Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA  35 U.S.C. 102 and 103 (or as subject to pre-AIA  35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.  
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.  Patentability shall not be negated by the manner in which the invention was made.

The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1.	Determining the scope and contents of the prior art.
2.	Ascertaining the differences between the prior art and the claims at issue.
3.	Resolving the level of ordinary skill in the pertinent art.
4.	Considering objective evidence present in the application indicating obviousness or nonobviousness.

This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary.  Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.

11. 	Claims 7 and 10-11 are rejected under AIA  35 U.S.C. 103 as being unpatentable over Karunakaran et al (SLC6A14 (ATB0,+) Protein, a Highly Concentrative and Broad Specific Amino Acid Transporter, Is a Novel and Effective Drug Target for Treatment of Estrogen Receptor-positive Breast Cancer, J. Biol. Chem. 286(36): 31830-31838, 2011), as applied to Claims 1, 4, and 9 above, and in further view of Wang et al (Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element, Int. J. Med. Sci. 13(4): 286-291, 2016). 
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Karunkaran et al taught a plasmid nucleic acid vector comprising a SLC6A14 promoter is operably linked to a transgene, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).

	Karunkaran et al do not teach wherein the nucleic acid vector is a viral vector, more specifically an AAV viral vector comprising an AAV8 capsid. 
However, prior to the effective filing date of the instantly claimed invention, Wang et al is considered relevant prior art for having taught the use of AAV8 viral vectors whose genomes comprise a 5’ ITR, a promoter, a transgene, a WPRE element, a bGH polyA sequence, and a 3’ ITR (e.g. Figure 1a).
Wang et al taught that AAV8 vectors are prepared using a helper cell expressing the plasmid encoding the AAV8 vector expression cassette, and the AAV rep and cap proteins, thereby packaging the AAV8 vector expression cassette within the AAV8 capsids (e.g. pg 287, col. 1, Methods, Preparation of rAAV8 vectors). 
Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons (e.g. pg 289, col. 2), and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes (e.g. Abstract). 

Resolving the level of ordinary skill in the pertinent art.
People of the ordinary skill in the art will be highly educated individuals such as medical doctors, scientists, or engineers possessing advanced degrees, including M.D.'s and Ph.D.'s. Thus, these people most likely will be knowledgeable and well-read in the relevant literature and have the practical experience in molecular biology and rAAV expression vectors. Therefore, the level of ordinary skill in this art is high. 
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR International Co. v. Teleflex Inc., 550 U.S. ___, ___, 82 USPQ2d 1385, 1397 (2007). "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at ___, 82 USPQ2d at 1396. 

Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first nucleic acid vector, e.g. a plasmid, as taught by Karunakaran et al, with a second nucleic acid vector, to wit, an rAAV8 viral vector, as taught by Wang al, with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” “Reading a list and selecting a known compound to meet known requirements is no more ingenious than selecting the last piece to put in the last opening in a jig-saw puzzle." 325 U.S. at 335, 65 USPQ at 301.).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first nucleic acid vector, e.g. a plasmid, with a second nucleic acid vector, to wit, an rAAV8 viral vector, because those of ordinary skill in the art have long-recognized the use of plasmids encoding rAAV expression constructs, thereby packaging the expression construct into AAV virus particles, and Wang et al taught that AAV8 vectors have been used extensively in the nervous system, targeting primarily neurons,  and that AAV8 was superior for transducing liver, brain, and muscle tissue, as compared to other serotypes.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. 

12. 	Claims 4-6, 9, and 15-16 are rejected under AIA  35 U.S.C. 103 as being unpatentable over Karunakaran et al (SLC6A14 (ATB0,+) Protein, a Highly Concentrative and Broad Specific Amino Acid Transporter, Is a Novel and Effective Drug Target for Treatment of Estrogen Receptor-positive Breast Cancer, J. Biol. Chem. 286(36): 31830-31838, 2011), as applied to Claims 1, 4, and 9 above, and in further view of Sajan et al (Toward a Systems Biology of Mouse Inner Ear Organogenesis: Gene Expression Pathways, Patterns and Network Analysis, Genetics 177: 631-653, 2007), Campbell et al (Scientific Reports 6: e19484, 16 pages, doi:10.1038/srep19484; available online Janaury 20, 2016), and Parker et al (An Independent Construct for Conditional Expression of Atonal Homolog-1, Human Gene Therapy 25: 13 pages; 2014). 
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Karunkaran et al taught a plasmid nucleic acid vector comprising a SLC6A14 promoter is operably linked to a reporter transgene, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).

	Karunkaran et al do not teach wherein the transgene encodes a therapeutic molecule, e.g. Atoh1. 
However, prior to the effective filing date of the instantly claimed invention, and with respect to Claims 5-6 and 15-16, 
Sajan et al is considered relevant prior art for having taught that SLC6A14 is a signature gene in the inner ear vestibular sense organ saccule (e.g. pg 631, col. 2; Table 4). 
Campbell et al is considered relevant prior art for having taught that Notch signaling plays an important and instructive role in the differentiation, homeostasis, and repair of glial-like supporting cells of the cochlea (e.g. Abstract), whereupon activated Notch signaling, the expression of SLC6A14 is significantly increased (e.g. pg 5, last para). 
Parker et al is considered relevant prior art for having taught that Atoh1 is required for cochlear hair cells that function as mechanosensory cells, and that forced expression of Atoh1 in cochlear-supporting cells may provide a way to regenerate hair cells, and provide for a therapy for hearing loss (e.g. Abstract). 
Parker et al taught nucleic acid expression vectors whose genomes encoded a promoter operably linked to: 
a reporter transgene, e.g. DsRed; 
a reporter transgene, e.g. DsRed, and a transgene encoding a therapeutic protein, e.g. Atoh1; or 
a transgene encoding a therapeutic protein, e.g. Atoh1 (Figure 1). 

Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first transgene, e.g. encoding a reporter protein, as taught by Karunakaran et al, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, as taught by Parker al, in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).”  When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first transgene, e.g. encoding a reporter protein, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, in a nucleic acid expression vector because those of ordinary skill in the art previously recognized SLC6A14 is inherently and naturally expressed in the inner ear cochlear support cells, including vestibular saccule (e.g. Sajan et al; Campbell et al), and have long-recognized the use of nucleic acid expression vectors to encode reporter transgenes and/or therapeutic protein transgenes, whereby Parker et al successfully demonstrated the ability of the routineer to substitute a first transgene encoding a reporter protein with a second transgene encoding a therapeutic protein, e.g. Atoh1.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
With respect to Claim 4, Karunkaran et al taught wherein the SLC6A14 promoter is operably linked to a transgene, e.g. a luciferase cDNA (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid; pg 31831, col. 2, “SLC6A14 promoter upstream of the luciferase cDNA”).
Parker et al taught wherein the promoter is operably linked to a transgene (Figure 1). 
	With respect to Claim 9, Karunkaran et al taught wherein the nucleic acid vector is a plasmid (e.g. pg 31831, col. 1, Methods, Construction of luciferase reporter plasmid).
Parker et al taught wherein the nucleic acid vector is a plasmid (e.g. 2, Methods, Generation of the Atoh1…constructs, “plasmid obtained from…”). 
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. 

13. 	Claims 2-3 are rejected under AIA  35 U.S.C. 103 as being unpatentable over Karunakaran et al (SLC6A14 (ATB0,+) Protein, a Highly Concentrative and Broad Specific Amino Acid Transporter, Is a Novel and Effective Drug Target for Treatment of Estrogen Receptor-positive Breast Cancer, J. Biol. Chem. 286(36): 31830-31838, 2011) and Wang et al (Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element, Int. J. Med. Sci. 13(4): 286-291, 2016), as applied to Claims 1, 4, and 9-11 above, and in further view of Trinklein et al (U.S. 2007/0161031).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
	As discussed above, the human SLC6A14 promoter isolated by Karunakaran et al is overall 94% identical to instant SEQ ID NO:4, and comprises a nucleotide sequence that is 100% identical to nucleotides 1-786 of instant SEQ ID NO:4.
The human SLC6A14 promoter isolated by Karunakaran et al differs from instant SEQ ID NO:4 in that it does not comprise the remaining 48 nucleotides of SEQ ID NO:4, to wit: 
	CACCTGCTACCAGTCAAGCTCAGCCAGACTGCAAGAGGAGGCGAGGCG
However, GenBank NB_021305.2 taught that SLC6A14 mRNA transcription begins at coordinate 4993, which corresponds to coordinate 2310 (underlined), as shown below:
2305 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 2364
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
 721 TCTTCATAAATGTTCCCACCCCTGGGCAAGGTGGCTCACTCTGGCAGGTAGGAACAGGGG 780

2365 AGAGTG 2370
     ||||||
 781 AGAGTG 786
Thus, the promoters of both Karunkaran et al and instant SEQ ID NO:4 comprise nucleotide sequences that are downstream of the SLC6A14 transcription start site, and upstream of the SLC6A14 translation start site (GenBank NB_021305.2 coordinate 5124; 23 nucleotides downstream of instant SEQ ID NO:4).
Trinklein et al is considered relevant prior art for having disclosed a promoter library, wherein said promoter library comprises a promoter (SEQ ID NO:44366; 2300nts) that is 99.6% identical (2 mismatches) to instant SEQ ID NO:4.

Considering objective evidence present in the application indicating obviousness or nonobviousness.
The focus when making a determination of obviousness should be on what a person of ordinary skill in the pertinent art would have known at the time of the invention, and on what such a person would have reasonably expected to have been able to do in view of that knowledge. This is so regardless of whether the source of that knowledge and ability was documentary prior art, general knowledge in the art, or common sense. M.P.E.P. §2141.
The rationale to modify or combine the prior art does not have to be expressly stated in the prior art; the rationale may be expressly or impliedly contained in the prior art or it may be reasoned from knowledge generally available to one of ordinary skill in the art, established scientific principles, or legal precedent established by prior case law. In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988); In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992). See also In re Kotzab, 217 F.3d 1365, 1370, 55 USPQ2d 1313, 1317 (Fed. Cir. 2000) (setting forth test for implicit teachings); In re Eli Lilly & Co., 902 F.2d 943, 14 USPQ2d 1741 (Fed. Cir. 1990) (discussion of reliance on legal precedent); In re Nilssen, 851 F.2d 1401, 1403, 7 USPQ2d 1500, 1502 (Fed. Cir. 1988) (references do not have to explicitly suggest combining teachings); and Ex parte Levengood, 28 USPQ2d 1300 (Bd. Pat. App. & Inter. 1993) (reliance on logic and sound scientific reasoning). See MPEP §2144.
Prior to the effective filing date of the instantly claimed invention, it would have been obvious to one of ordinary skill in the art to substitute a first SCL6A14 promoter that is 94% identical to instant SEQ ID NO:4, as taught by Karunakaran et al, with a second SLC6A14 promoter that is 99.6% identical to instant SEQ ID NO:4, as disclosed by Trinklein et al, in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).” When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. An artisan would be motivated to substitute a first SCL6A14 promoter that is 94% identical with instant SEQ ID NO:4 with a second SCL6A14 promoter that is 99.6% identical to instant SEQ ID NO:4 in a nucleic acid expression vector because those of ordinary skill in the art have long-recognized and successfully reduced to practice the ability to substitute promoters having different lengths in an expression vector (e.g. Trinklein et al, Figure 3A). 
In the case where the claimed ranges "overlap or lie inside ranges disclosed by the prior art" a prima facie case of obviousness exists. In re Wertheim, 541 F.2d 257, 191 USPQ 90 (CCPA 1976); In re Woodruff, 919 F.2d 1575, 16 USPQ2d 1934 (Fed. Cir. 1990). It is routine procedure to optimize component amounts to arrive at an optimal product that is superior for its intended use, since it has been held where the general conditions of a claim are disclosed in the prior art, discovering the optimum or workable ranges involves only routine skill in the art. Similarly, a prima facie case of obviousness exists where the claimed ranges or amounts do not overlap with the prior art but are close enough that one skilled in the art would have expected them to have the same properties. See M.P.E.P. §2144.05(I). 
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the additional 48 nucleotides 3’ downstream of the Karunkaran et al SLC6A14 promoter, and Karunkaran et al successfully demonstrated the ability of their SLC6A14 promoter to drive expression of the artisan’s desired transgene. 
Neither the instant specification, prior art, nor post-filing art teach the presence of any particular transcription factor binding site(s) the additional 48 nucleotides 3’ downstream of the Karunkaran et al SLC6A14 promoter that are material to SLC6A14 promoter function/activity, be it in vitro and/or in vivo. 
Rather, as discussed in the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections, the breadth of the independent claim encompasses as many as 125 (85% identity) nucleotide substitutions, insertions, and/or deletions anywhere in the SCL6A14 promoter, for which the Karunkaran et al SLC6A14 promoter is at least 94% identical to instant SEQ ID NO:4, but for the remaining 48 nucleotides 3’ downstream.
Instant specification fails to disclose an element of criticality for an additional 2, 5, 10, 12, 17, 21, 26, 32, 37, 40, 42, 45, and/or 48 nucleotides 3’ downstream of the Karunkaran et al SLC6A14 promoter, nor the 2 nucleotide mismatches of the Trinklein et al SLC6A14 promoter.
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. 

14. 	Claims 2-8, 10, and 15-16 are rejected under AIA  35 U.S.C. 103 as being unpatentable over Karunakaran et al (SLC6A14 (ATB0,+) Protein, a Highly Concentrative and Broad Specific Amino Acid Transporter, Is a Novel and Effective Drug Target for Treatment of Estrogen Receptor-positive Breast Cancer, J. Biol. Chem. 286(36): 31830-31838, 2011), Wang et al (Enhancing Transgene Expression from Recombinant AAV8 Vectors in Different Tissues Using Woodchuck Hepatitis Virus Post-Transcriptional Regulatory Element, Int. J. Med. Sci. 13(4): 286-291, 2016), and  Trinklein et al (U.S. 2007/0161031), as applied to Claims 1-4 and 9-11 above, and in further view of Sajan et al (Toward a Systems Biology of Mouse Inner Ear Organogenesis: Gene Expression Pathways, Patterns and Network Analysis, Genetics 177: 631-653, 2007), Campbell et al (Scientific Reports 6: e19484, 16 pages, doi:10.1038/srep19484; available online Janaury 20, 2016), Parker et al (An Independent Construct for Conditional Expression of Atonal Homolog-1, Human Gene Therapy 25: 13 pages; 2014), Edge (U.S. Patent 9,896,658), and Wang et al (U.S. 2019/0076550; filed October 15, 2018).
Determining the scope and contents of the prior art, and Ascertaining the differences between the prior art and the claims at issue.
Claim 8 is directed to a nucleic acid vector whose genome encodes, in 5’ to 3’ order (Specification Table 4, pgs 33-38):
a 5’ inverted terminal repeat nucleotide sequence at least 80% identical to nucleotides 1-130 of SEQ ID NO:7; 
an SLC6A14 promoter comprising the nucleotide sequence of nucleotides 233-1066 of SEQ ID NO:7 (syn. SEQ ID NO:4); 
an Atoh1 cDNA comprising the nucleotide sequence of nucleotides 1083-2144 of SEQ ID NO:7; 
a woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7; 
a bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7; and
	a 3’ inverted terminal repeat nucleotide sequence at least 80% identical to nucleotides 3010-3139 of SEQ ID NO:7.

As discussed above, Karunkaran et al and Trinklein et al teach/disclose a SCL6A14 promoter that is 94% or 99.6% identical to instant SEQ ID NO:4. 
The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the additional 48 nucleotides 3’ downstream of the Karunkaran et al SLC6A14 promoter, and Karunkaran et al successfully demonstrated the ability of their SLC6A14 promoter to drive expression of the artisan’s desired transgene. 
Neither the instant specification, prior art, nor post-filing art teach the presence of any particular transcription factor binding site(s) the additional 48 nucleotides 3’ downstream of the Karunkaran et al SLC6A14 promoter that are material to SLC6A14 promoter function/activity, be it in vitro and/or in vivo. 
Rather, as discussed in the above 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, and 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, rejections, the breadth of the independent claim encompasses as many as 125 (85% identity) nucleotide substitutions, insertions, and/or deletions anywhere in the SCL6A14 promoter, for which the Karunkaran et al SLC6A14 promoter is at least 94% identical to instant SEQ ID NO:4, but for the remaining 48 nucleotides 3’ downstream.
Instant specification fails to disclose an element of criticality for an additional 2, 5, 10, 12, 17, 21, 26, 32, 37, 40, 42, 45, and/or 48 nucleotides 3’ downstream of the Karunkaran et al SLC6A14 promoter, nor the 2 nucleotide mismatches of the Trinklein et al SLC6A14 promoter.

As discussed above, Sajan et al, Campbell et al, and Parker et al renders obvious the substitution of a first transgene, e.g. encoding a reporter protein, as taught by Karunakaran et al and/or Trinklein et al, with a second transgene, to wit, encoding a therapeutic protein, e.g. Atoh1, as taught by Parker al, being operably linked to a SLC6A14 promoter in a nucleic acid expression vector with a reasonable expectation of success because the simple substitution of one known element for another would have yielded predictable results to one of ordinary skill in the art at the time of the invention. M.P.E.P. §2144.07 states "The selection of a known material based on its suitability for its intended use supported a prima facie obviousness determination in Sinclair & Carroll Co. v. Interchemical Corp., 325 U.S. 327, 65 USPQ 297 (1945).”  When substituting equivalents known in the prior art for the same purpose, an express suggestion to substitute one equivalent component or process for another is not necessary to render such substitution obvious. In re Fout, 675 F.2d 297, 213 USPQ 532 (CCPA 1982). M.P.E.P. §2144.06. 

Wang et al is considered relevant prior art for having disclosed rAAV expression vectors whose genomes encode: 
a 5’ inverted terminal repeat nucleotide sequence 100% identical to nucleotides 1-130 of SEQ ID NO:7; 
a woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7; 
a bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7; and
	a 3’ inverted terminal repeat nucleotide sequence 100% identical to nucleotides 3010-3139 of SEQ ID NO:7, as illustrated in Figure 1.
	Thus, the combination of these elements has long-been known and successfully reduced to practice in rAAV expression vectors. 

Edge is considered relevant prior art for having disclosed plasmids or viral vectors, including rAAV vectors (e.g. col. 14, lines 35-44) encoding an Atoh1 nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7.
Thus, mere placement of an Atoh1 cDNA nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7 into an rAAV expression vector comprising the 5’ITR, WPRE element, bGH polyA, and 3’ITR is obvious, as such is merely cloning the previously known Atoh1 cDNA into the previously known rAAV expression vector.
Similarly, mere placement of the SLC6A14 promoter nucleotide sequence of SEQ ID NO:4 operably linked to a Atoh1 cDNA nucleotide sequence that is 100% to nucleotides 1083-2144 of SEQ ID NO:7 into an rAAV expression vector comprising the 5’ITR, WPRE element, bGH polyA, and 3’ITR is obvious, as such is merely cloning the prior art SLC6A14 promoter(s) and/or obvious variant(s) thereof to the previously known Atoh1 cDNA into the previously known rAAV expression vector.

The "mere existence of differences between the prior art and an invention does not establish the invention's nonobviousness." Dann v. Johnston, 425 U.S. 219, 230, 189 USPQ 257, 261 (1976). The gap between the prior art and the claimed invention may not be "so great as to render the [claim] nonobvious to one reasonably skilled in the art."Id.
Instant specification fails to disclose an element of criticality for the specific vector backbone nucleotide sequences that intervene:
the SLC6A14 promoter comprising the nucleotide sequence of nucleotides 233-1066 of SEQ ID NO:7; 
the Atoh1 cDNA comprising the nucleotide sequence of nucleotides 1083-2144 of SEQ ID NO:7; 
the woodchuck posttranscriptional regulatory element (WPRE) comprising the nucleotide sequence of nucleotides 2155-2702 of SEQ ID NO:7; and
the bovine growth hormone (bGH) polyadenylation sequence comprising the nucleotide sequence of nucleotides 2715-2922 of SEQ ID NO:7. 
It is proper to "take account of the inferences and creative steps that a person of ordinary skill in the art would employ." KSR Int'l Co. v. Teleflex Inc., 127 S. Ct. 1727, 1741,82 USPQ2d 1385, 1396 (2007). See also Id. At 1742, 82 USPQ2d 1397 ("A person of ordinary skill is also a person of ordinary creativity, not an automaton.").
It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness. See the recent Board decision Ex parte Smith, —USPQ2d—, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925 .pdf).
The cited prior art meets the criteria set forth in both Graham and KSR, and the teachings of the cited prior art provide the requisite teachings and motivations with a clear, reasonable expectation of success. Thus, the invention as a whole is prima facie obvious. 

Conclusion
14.  	Claims 1-11, 13, and 15-19 are rejected. 
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEVIN K. HILL whose telephone number is (571)272-8036. The examiner can normally be reached 12pm-8pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached on 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.

KEVIN K. HILL
Examiner
Art Unit 1638



/KEVIN K HILL/Primary Examiner, Art Unit 1638