Patent Application 15852526 - GENE EDITING OF PCSK9

Title: GENE EDITING OF PCSK9

Application Information

Invention Title: GENE EDITING OF PCSK9
Application Number: 15852526
Submission Date: 2025-04-10T00:00:00.000Z
Effective Filing Date: 2017-12-22T00:00:00.000Z
Filing Date: 2017-12-22T00:00:00.000Z
National Class: 514
National Sub-Class: 04400R
Examiner Employee Number: 95266
Art Unit: 1637
Tech Center: 1600

Rejection Summary

102 Rejections: 0
103 Rejections: 6

Cited Patents

The following patents were cited in the rejection:

Office Action Text

DETAILED ACTION

Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .

Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 3/24/2025 has been entered.

Application Status
The Amendments and Remarks filed 23 January 2025 in response to the Office Action 23 October 2024 are acknowledged and have been entered. Claims 1, 110, 141, and 146 are amended. Claims 5, 7-13, 15-33, 35-69, 71-109, 111-123, 125-128, 134 and 142-143 are canceled. Claims 160-161 are newly added. Claims 1-4, 6, 14, 34, 70, 110, 124, 129-133, 135-141 and 144-161 are pending and being examined on the merits.

Priority
Acknowledgment is made of applicant’s claim for priority based on applications 62/438,869 filed December 23, 2016.

Information Disclosure Statement
The information disclosure statements filed 03/24/2025 have been considered.

Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.

This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.

Claims 1-4, 6, 34, 70, 110, 124, 129-133, 137, 141, 144-145, 149-152, 156 and 160-161 are rejected under 35 U.S.C. 103 as being unpatentable over Nishida (US 2017/0073670) in view of Kitamura (Kitamura et al. (2013) PLOS Pathogen, 9:e1003361), Studebaker (Studebaker et al. Biochemical and Biophysical Research Communications 334 (2005) 509–515), Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), and NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages).
Regarding claims 1-3, 6, 70, 151-152 Nishida teaches a method of converting one or more nucleotides in a targeted site of a target double stranded DNA (i.e., polynucleotide) to one or more other nucleotides (i.e., editing) [0015] by contacting the target polynucleotide with (i) a fusion protein [0046] comprising (a) a Cas9 nickase comprising the D10A and H840A mutation [0097, 0154; regarding claims 2-4 and 6] and (b) a PMCDA1 or AID (i.e., cytosine deaminase domain) [0038], and (ii) a guide RNA targeting the fusion protein of (i) [0096; regarding claim 70]. Nishida further teaches wherein the guide RNA targets the nCas9 (D10A) or dCas9 to a target cytosine that is located in the center of the sequence to which the guide RNA hybridizes [0134, 0138; Fig. 5, 6], and results in the deamination of the target C base by the fusion protein resulting in a cytosine (C) to thymine (T) change in the target polynucleotide [0038, 0160, Fig. 12]. Nishida teaches wherein the method causes a C to T mutation that results in the introduction of a stop codon [0167, Fig. 16]. Furthermore, Nishida further explains that for the Cas9 nickase (D10A) the mutations gather in the center of the target sequence [0113, 0138].

Nishida does not teach wherein the fusion protein further comprises (c) a uracil glycosylase inhibitor (UGI) domain. Nishida does not teach wherein the target polynucleotide encodes PCSK9. Nishida does not teach wherein the C to T change leads to mutation of a single amino acid in the PCSK9 protein selected from the group consisting of W10X, W11X, Q31X, Q90X, Q99X, Q101X, O152X, W156X, Q172X, Q190X, Q219X, Q256X, Q275X, Q278X, Q302X, Q342X, Q344X, Q382X, Q387X, Q413X, W428X, Q433X, W453X, Q454X, W461X, Q503X, Q531X, Q554X, Q555X, W566X, R582X, Q584X, Q587X, Q619X, Q621X, W630X, Q686X, and Q689X, wherein X is a stop codon. Nishida do not teach wherein the guide nucleotide sequence is according to the elected SEQ ID NO: 943.

Kitamura similarly teaches that cytidine deaminase-mediated deamination of cytidine residue to uracil on DNA or RNA is repaired by the uracil-DNA glycosylase [abstract]. Kitamura teaches that co-expression of UGI, an inhibitor of uracil-DNA glycosylase (UNG), with the cytidine deaminase, including APOBEC3G (same as an APOBEC family deaminase) increases the C to T mutation [abstract; figure 1 in particular].

Studebaker teaches that a UGI fusion protein was capable of inhibiting UNG activity [abstract].

Zhang ‘770 similarly teaches applications for using Cas9 to edit a target genomic locus of interest in eukaryotic cells to improve the status or a disease or a condition [abstract]. Zhang ‘770 teaches that PCSK9 is primarily expressed by the liver and is critical for the down regulation of hepatocyte LDL receptor expression. Zhang ‘770 teaches that LDL-C levels in plasma are highly elevated in humans with gain of function mutations in PCSK9. Accordingly, Zhang ‘770 teaches that PCSK9 is an attractive target for CRISPR [0337]. Zhang ‘770 specifically teaches the use of Cas9 to introduce protective mutations that inactivate PCSK9 for cholesterol reduction [0863]. For example, Zhang ‘770 similarly describes the substitution of a single nucleotide for another nucleotide such that a stop codon is introduced [0586]. Additionally, Zhang teaches protein domains that may be fused to Cas9, a CRISPR enzyme, that has the ability to modify nucleic acids [0543]. Zhang teaches that these fusion proteins can be expressed in fusion vectors for increased protein expression or solubility [0499]. In addition, Zhang ‘770 describes criteria for a guide sequence of a guide RNA including that it consists of a 20-nt guide sequence in which directly upstream of the target sequence is a NGG PAM sequence in the case of S. pyogenes Cas9 [0086].

Mintier teaches diagnostic and therapeutic methods for applying novel PCSK9b, PCSK9c, and N and C-terminal truncated forms of PCSK9 polypeptides to the diagnosis, treatment, and/or prevention of various diseases and/or disorders related to these polypeptides [abstract, 0075, 0106]. Mintier teaches polynucleotides comprising, or alternatively consisting of, a sequence encoding the C-terminal PCSK9c deletion polypeptides of W10, W11, Q31, Q90, Q99, Q101, O152, W156, Q172, Q190, Q219, Q256, Q275, Q278, Q302, Q342, Q344, Q382, Q387, Q413, W428, Q433, W453, Q454, W461, Q503, Q531, Q554, Q555, W566, R582, Q584, Q587, Q619, Q621, W630, Q686, and Q689 [0170]. Mintier teaches that the variants and early truncation of the C-terminal domain is a consequence of an in-frame stop codon [0069].

The reference sequence for PCSK9, which teaches a sequence that is 100% identical to SEQ ID NO: 943, was known as illustrated by NM_174936.3, which identifies the coding sequence as spanning nucleotide positions 363-2441 [page 3]. Although the reference sequence refers only to a plus-sense nucleotide sequence, given that it is referring to a gene sequence, this disclosure of one strand of a double-stranded DNA necessarily describes to one of ordinary skill in the art the complementary sequence, which follows Watson-Crick base pairing as set forth below:
M G T V S S R R S W W P L P L L L L L
361 TCATGGGCACCGTCAGCTCCAGGCGGTCCTGGTGGCCGCTGCCACTGCTGCTGCTGCTGC 420

AGTACCCGTGGCAGTCGAGGTCCGCCAGGACCACCGGCGACGGTGACGACGACGACGACG

It would have been obvious to one of ordinary skill in the art to have modified the fusion protein of Cas9/cytidine deaminase of Nishida to further comprise a UGI domain as taught by Kitamura and Studebaker. One of ordinary skill in the art would have been motivated to have made this modification for the advantage of increasing the C to T mutation efficiency as described by Kitamura, since Studebaker teaches that a UGI fusion protein is also able to inhibit UNG activity. One of ordinary skill in the art would have been motivated to have fused this additional UGI domain to the fusion protein since Nishida describes that a Cas fusion protein can comprise multiple different effector domains and Zhang teaches expressing Cas9 fusion proteins in a fusion vector for increased protein expression or solubility. Since each of Nishida and Kitamura are directed to the use of cytidine deaminase to achieve deamination of cytidine residues, one of ordinary skill in the art would have had a reasonable expectation of success in doing so. One would have had a reasonable expectation of success that the UGI fused to the fusion protein comprising Cas9 and the cytidine deaminase would have been particularly well positioned in proximity to the target sequence of interest to increase the C to T mutation efficiency of the targeted cytosine because Nishida teaches targeted gene editing and Studebaker teaches that a UGI fusion protein still retained functionality.

It further would have been obvious to one of ordinary skill in the art to have specifically targeted a cytosine in a polynucleotide encoding PCSK9 by using the method of Nishida whereby the targeted cytosine is deaminated resulting in a cytosine to thymine mutation of a single amino acid in the PCSK9 protein selected from the group consisting of W10X, W11X, Q31X, Q90X, Q99X, Q101X, O152X, W156X, Q172X, Q190X, Q219X, Q256X, Q275X, Q278X, Q302X, Q342X, Q344X, Q382X, Q387X, Q413X, W428X, Q433X, W453X, Q454X, W461X, Q503X, Q531X, Q554X, Q555X, W566X, R582X, Q584X, Q587X, Q619X, Q621X, W630X, Q686X, and Q689X. One of ordinary skill would be motivated given Zhang ‘770 teachings that PCSk9 is an attractive target for CRISPR to inactivate PCSK9 for cholesterol reduction and Mintier teachings of the specific mutation of PCSK9 that results in truncated PCSK9 variants. Furthermore, Mintier teaches the deletion mutants as claimed. Accordingly, it would have been entirely predictable to have applied the method of Nishida for target gene editing using a cytosine deaminase fused to Cas9 to the target genes described by Zhang ‘770 and arrive at the PCSK9 mutants of Mintier. One of ordinary skill would be motivated to target a cytosine in PCSK9 and converted it into thymine for the advantage of introducing a stop codon into the gene thereby generating a PCSK9 mutant which could be screened to be useful for treatment, and/or prevention of various diseases and/or disorders, such as cholesterol, as described by Zhang ‘770 and Mintier. One of ordinary skill would have a reasonable expectation of success since both Nishida and Zhang ‘700 both teach methods for using CRISPR-Cas9 to achieve target DNA editing and modification.

It would have been obvious to one of ordinary skill in the art to have tried to arrive at a guide RNA comprising instant SEQ ID NO: 943 for the following reasons. The PCSK9 gene sequence was known as illustrated by NM_174936.3. In addition, the obviousness of targeting and converting a cytosine to thymine to introduce a stop codon is discussed above. Based on these disclosures, one of ordinary skill in the art would have been in need of identifying a cytosine that, when converted into thymine, would result in a stop codon and further wherein the nucleotide sequence meets the criteria of an acceptable guide sequence including the presence of the PAM. However, there would have been a finite number of possible guide sequence candidates that would have met these characteristics based on the PCSK9 gene sequence as illustrated by NM_174936.3. The guide sequence of SEQ ID NO: 943 meets these criteria including it being 20 nucleotides in length, the presence of an upstream TGG (i.e., NGG PAM sequence motif), the targeted cytosine is centered within the target sequence, and C to T conversion in the central cytosine would result in the conversion of the codon TGG to the stop codon TAG in the complementary strand. In addition, one of ordinary skill in the art would have so recognized SEQ ID NO: 943 as such an attractive guide sequence based on the high level of skill in the art, the knowledge of the PCSK9 gene sequence as illustrated by NM_174936.3, and further the knowledge in the art regarding desirable guide sequences as discussed by Zhang ‘770. Accordingly, one of ordinary skill in the art could have modified a guide RNA that targets PCSK9 to comprise the guide sequence of SEQ ID NO 943 and it would have been entirely predictable that such a guide sequence would have been useful for the targeting and conversion of a target cytosine for the introduction of a stop codon into the PCSK9 gene sequence.
Regarding claim 4, Nishida teaches the embodiment in which the Cas9 nickase comprises a D10A mutation of SEQ ID NO: 5. SEQ ID NO: 5 has an amino acid sequence that is 100% identical to the instant SEQ ID NO: 1.
Regarding claims 34, the obviousness of the mutation in thePCSK9 gene by introducing a stop codon that leads to a truncated or non-functional PCSK9 protein is discussed above as applied to claim 1.
Regarding claim 110 and 124, the combined teachings of Nishida, Kitamura, Zhang ‘770, and Mintier are discussed above as applied to claim 1 and similarly apply to claim 110. Zhang ‘770 additionally teaches delivering a therapeutically effective [0367] pharmaceutical compositions comprising a CRISPR-Cas gene therapy particle for the treatment of a subject [0037] and [0337]. It would have been obvious to have made and administered a therapeutically effective composition comprising the fusion protein and guide RNA as taught and suggested by Nishida, Kitamura, Zhang ‘770, and Mintier targeting the PCSK9 gene for the advantage of delivering the composition to a subject to reduce cholesterol in the subject.
Regarding claims 129-131, 141 and 160-161, the embodiment in which the guide nucleotide sequence-programmable DNA-binding protein domain is a nuclease inactive Cas9 domain comprising a mutation corresponding to the D10A and H840A mutation in SEQ ID NO: 1 is discussed above as applied to claim 1, 4 and 6.
Regarding claim 132, Nishida’s disclosure in which the cytosine deaminase is AID [0038] is discussed above.
Regarding claim 133, Nishida teaches wherein the cytidine deaminase has the PmCDA1 amino acid sequence of SEQ ID NO: 2 [0039, page 17], which is identical to instant SEQ ID NO: 289 encoding PmCDA1.
Regarding claim 137 and 156, Nishida teaches the use of a linker to fuse the Cas9 domain with other functional domains [Fig. 1 and Fig. 2 construct].
Regarding claim 144 and 145, Mintier teaches the PCSK9 mutants that consist of truncations as W10, W11, Q99, Q101, Q342, Q344, Q554, and Q555. It would have been obvious where in the method and composition as taught and suggested by Nishida, Kitamura, Zhang ‘770, and Mintier has a mutation in the PCSK9 protein that comprises tandem stop codons of W10X-W11X, Q99X-Q101X, Q342X-Q344X, and Q554X-Q555X. One of ordinary skill would be motivated with an expectation of success since mutants that comprise the tandem stop codons as claimed would result in structurally similar mutants with similar biological function as the single stop codon mutants of W11X, Q101X, Q334X, and Q555X.
Regarding claims 149 and 150, Nishida teaches the TAA stop codon [0156].

Claims 14 and 153 are rejected under 35 U.S.C. 103 as being unpatentable over Nishida (US 2017/0073670) in view of Kitamura (Kitamura et al. (2013) PLOS Pathogen, 9:e1003361), Studebaker (Studebaker et al. Biochemical and Biophysical Research Communications 334 (2005) 509–515), Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), and NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages) as applied to claim 1 and 110 above, and further in view of Liu (US 2015/0166980).
The teachings of Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 are discussed above as applied to claim 1 and similarly apply to claim 14.

Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 do not teach wherein the cytosine deaminase protein comprises an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase. However, Kitamura’s disclosure in which APOBEC3G is used for deamination of cytidines is discussed above.

In addition, Liu similarly describes methods for achieving targeted editing of nucleic acids by contacting the targeted nucleic acids with a Cas9 fused to a cytosine deaminase, wherein the cytosine deaminase is an apolipoprotein B mRNA-editing complex (APOBEC) family deaminase [0007, 0008].

It would have been obvious to one of ordinary skill in the art to have used an APOBEC family deaminase as the cytosine deaminase in the method of Nishida because it would have merely amounted to a simple substitution of one known cytosine deaminase for another to yield predictable results. Given that each of Nishida and Liu teach similar methods of using CRISPR-Cas9 fusion proteins comprising cytosine deaminase for the common purpose of deaminating a target cytosine in a target polynucleotide, one of ordinary skill in the art could have made this substitution. Since each of the cytosine deaminases share the common function of deaminating cytosines, it would have been entirely predictable to have done so.

Claims 135 and 154 are rejected under 35 U.S.C. 103 as being unpatentable over Nishida (US 2017/0073670) in view of Kitamura (Kitamura et al. (2013) PLOS Pathogen, 9:e1003361), Studebaker (Studebaker et al. Biochemical and Biophysical Research Communications 334 (2005) 509–515), Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), and NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages) as applied to claim 1 above, and further in view of YP_009283008.1 (Bacillus phage AR9 uracil DNA glycosylase inhibitor, NCBI Reference Sequence, priority to September 23, 2016, 2 pages).
The teachings of Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 are discussed above.

Regarding claim 135, Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 do not teach wherein the UGI domain comprises SEQ ID NO: 304.

However, the amino acid sequence of SEQ ID NO: 304 refers to a known amino acid sequence that was known to encode a uracil DNA glycosylase inhibitor from Bacillus phage AR9 as illustrated by NCBI Reference sequence YP_009283008.1.

It would have been obvious to one of ordinary skill in the art to have substituted the UGI of Kitamura for one that comprised YP_009283008.1 because it would have merely amounted to a simple substitution of one known uracil DNA glycosylase inhibitor for another. Given that each of these proteins shares the common function of a uracil DNA glycosylase inhibitor, it would have been entirely predictable that the uracil DNA glycosylase inhibitor described by YP_009283008.1 would have been useful in enhancing the C to T mutation in the method of Nishida.

Claims 136, 138, 139, 155, 157-158 are rejected under 35 U.S.C. 103 as being unpatentable over Nishida (US 2017/0073670) in view of Kitamura (Kitamura et al. (2013) PLOS Pathogen, 9:e1003361), Studebaker (Studebaker et al. Biochemical and Biophysical Research Communications 334 (2005) 509–515), Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), and NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages) as applied to claim 1 and 137 above, and further in view of Doudna (US 2014/0068797).
The teachings of Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 are discussed above.
Regarding claim 136, 138, 155 and 157, to the extent that Nishida does not teach the particular arrangement of “wherein the cytosine deaminase domain is fused to the N-terminus of the guide nucleotide sequence-programmable DNA binding protein domain and the UGI domain is fused to the C-terminus of the guide nucleotide sequence-programmable DNA binding domain”, it is noted that Zhang ‘770 describes the fusion of heterologous amino acid sequence to each of the amino terminus and the carboxy terminus of Cas9 [FIG. 34].
In addition, Doudna similarly describes the fusion of heterologous amino acid sequences to Cas9. Doudna specifically teaches “In some embodiments, the heterologous sequence can be fused to the C-terminus of the dCas9 polypeptide. In some embodiments, the heterologous sequence can be fused to the N-terminus of the dCas9 polypeptide” [0420].
It would have been obvious to one of ordinary skill in the art to have tried to fuse the cytosine deaminase to the N-terminus of Cas9 and the UGI domain fused to the C-terminus of Cas9. Given the combination of the three protein domains of Cas9, cytosine deaminase, and a uracil DNA glycosylase inhibitor, there would have been a finite number of possible permutations. In addition, the combination of Zhang ‘770’s and Doudna’s disclosures as discussed above indicate that it was well within the level of ordinary skill in the art to choose the sequence in which the protein domains would be fused together. Furthermore, Zhang ‘770’s disclosure in which heterologous sequences were simultaneously fused to each of the amino terminus and the carboxy terminus (see FIG. 34) would have further led one of ordinary skill in the art to the embodiment in which Cas9 was flanked by each of the cytosine deaminase and the UGI. Accordingly, it would have required no more than routine experimentation to have arrived at the sequence of domains in which the cytosine deaminase domain is fused to the N-terminus of the guide nucleotide sequence-programmable DNA binding protein domain and the UGI domain is fused to the C-terminus of the guide nucleotide sequence-programmable DNA binding domain.
Regarding claims 139, 156, and 158, it is noted that claims recites that the linker is “optional”. Accordingly, referring to the structure of a linker that is “optional” is not sufficient to distinguish the claim from the prior art.
Nevertheless, Nishida [0131; Fig. 11] and Zhang ‘770 [Table 1] teaches the use of a GGGGS linker and (EAAAK)3 linker to separate fusion protein domains.
It would have been obvious to one of ordinary skill in the art to have used a linker having the structure recited by claims 139, 156 and 158 to separate the protein domains because Nishida and Zhang ‘770 teaches using such linkers to separate protein domains. One of ordinary skill in the art would have been motivated to have done so for the advantage of providing the fusion protein flexibility in its structure.

Claims 140 and 159 is rejected under 35 U.S.C. 103 as being unpatentable over Nishida (US 2017/0073670) in view of Kitamura (Kitamura et al. (2013) PLOS Pathogen, 9:e1003361), Studebaker (Studebaker et al. Biochemical and Biophysical Research Communications 334 (2005) 509–515), Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), and NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages) as applied to claim 1 above, and further in view of Zhang (US 2016/0208243, published July 21, 2016 and filed December 18, 2015, hereinafter referred to as Zhang ‘243).
The teachings of Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 are discussed above.

Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 do not teach wherein the fusion protein comprises SEQ ID NO: 10.

However, Zhang ‘243 describes novel DNA targeting CRISPR effector proteins and guide RNAs [abstract]. Zhang ‘243 specifically describes the cloning of Francisella tularensis subsp. Novicida Cpf1 and further using this enzyme and guide RNA to achieve plasmid interference activity [1696]. Zhang ‘243 describes the amino acid sequence for FnCpf1 as SEQ ID NO 82, which is identical to instant SEQ ID NO 10 [pages 207-208]. Zhang ‘243 further teaches using Cpf1 to mediate robust genome editing in human cell lines [0156]. Zhang ‘243 further describes making fusion proteins comprising FnCpf1 [0158]. Zhang ‘243 further teaches that Cpf1 effector proteins preferably target T-rich PAMs [0041].

It would have been obvious to one of ordinary skill in the art to have substituted the Cas9 protein of Nishida for the Cpf1 protein and Cpf1 guide RNA of Zhang because it would have merely amounted to a simple substitution of one known DNA-targeting CRISPR effector system for another to yield predictable results. Given the disclosure that FnCpf1 and its guide RNA were described by Zhang ‘243 as being used in a similar way as Cas9 and its guide RNA as described by Nishida, namely to achieve guide-RNA targeted DNA editing, one would have been motivated to have made this substitution for the advantage of targeting different regions in view of the different PAM sequence preference. In addition, since Zhang ‘243 similarly teaches making fusion proteins comprising Cpf1, it would have been entirely predictable to have similarly used Cpf1 as the effector protein in the fusion protein of Nishida.

Claim 146 and 148 is rejected under 35 U.S.C. 103 as being unpatentable over Nishida (US 2017/0073670) in view of Kitamura (Kitamura et al. (2013) PLOS Pathogen, 9:e1003361), Studebaker, Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), and NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages) as applied to claim 1 above, and further in view of Ai (Ai et al. 2016. Biochemistry & Molecular Biology Journal Vol. 2 No. 3: 17).
The teachings of Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 are discussed above.

Regarding claims 146 and 148, Nishida, Kitamura, Studebaker, Zhang ‘770, Mintier, and NM_174936.3 do not teach wherein the premature stop codon is introduced after a structurally destabilizing mutation.
Ai teaches that the S462P and A552T PCSK9 mutations destabilize the C-terminal domain of PCSK9 and present with a loss of function phenotype [pg. 2, col. 1, para 3]. Ai teaches that these mutations correlate with an impact on folding and secretion of PCSK9 thereby decreasing plasma LDL-c levels [pg. 1-pg. 2, col.1, para 3].
It would have been obvious to one of ordinary skill in the art to have introduced the premature stop codons Q531X, R582X, and Q619X, wherein X is a stop codon as taught and suggested by Nishida, Kitamura, Zhang ‘770 and Mintier after the structurally destabilizing mutations of S462P and A552T as taught by Ai. One of ordinary skill would have been motivated to make the mutation for the advantage increasing a loss of function PCSK9 phenotype and thereby decreasing plasma LDL-c levels as taught by Ai. One of ordinary skill would have a reasonable expectation of success given that Zhang ‘770 and Ai teach PCSK9 mutations that lead to decreased plasma LDL-c levels.

Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.

Claims 1-4, 6, 14, 34, 70, 110, 124, 129-133, 135-141, 144-146, and 148-161 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No. 10,167,457 in view of Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), Liu (US 2015/0166980), NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages), YP_009283008.1 (Bacillus phage AR9 uracil DNA glycosylase inhibitor, NCBI Reference Sequence, priority to September 23, 2016, 2 pages), Doudna (US 2014/0068797), and Zhang (US 2016/0208243, published July 21, 2016 and filed December 18, 2015, hereinafter referred to as Zhang ‘243) and (Ai et al. 2016. Biochemistry & Molecular Biology Journal Vol. 2 No. 3: 17).
The patented claims recite a fusion protein comprising a Cas9 domain, cytidine deaminase, and uracil glycosylase inhibitor domain, wherein the Cas9 domain binds a guide RNA that specifically binds a target nucleic acid sequence.
The patented claims do not teach a method of using the patented fusion protein to target the guide RNA to a target cytosine in PCSK9 that is converted to thymine by the deaminase wherein the C to T change leads to mutation of a single amino acid in the PCSK9 protein selected from the group consisting of W10X, W11X, Q31X, Q90X, Q99X, Q101X, O152X, W156X, Q172X, Q190X, Q219X, Q256X, Q275X, Q278X, Q302X, Q342X, Q344X, Q382X, Q387X, Q413X, W428X, Q433X, W453X, Q454X, W461X, Q503X, Q531X, Q554X, Q555X, W566X, R582X, Q584X, Q587X, Q619X, Q621X, W630X, Q686X, and Q689X, wherein X is a stop codon and wherein the guide nucleotide sequence comprises SEQ ID NO: 943.
However, the teachings of Zhang ‘770, Mintier and NM_174936.3 are discussed above.
It would have been obvious to have combined the patented fusion protein with a guide RNA comprising a guide sequence that targets a targeted cytosine in a gene encoding PCSK9 to arrive at PCSK9 mutants at positions W10, W11, Q31, Q90, Q99, Q101, O152, W156, Q172, Q190, Q219, Q256, Q275, Q278, Q302, Q342, Q344, Q382, Q387, Q413, W428, Q433, W453, Q454, W461, Q503, Q531, Q554, Q555, W566, R582, Q584, Q587, Q619, Q621, W630, Q686, and Q689. One of ordinary skill would be motivated given Zhang ‘770 teachings that PCSk9 is an attractive target for CRISPR to inactivate PCSK9 for cholesterol reduction and Mintier teachings of the specific mutation if PCSK9 that results truncated PCSK9 variants. One would have been motivated and had a reasonable expectation of success to have targeted a cytosine in PCSK9 and converted it into thymine for the advantage of introducing a stop codon and arrive at the PCSK9 mutants which could be screened to be useful for treatment, and/or prevention of various diseases and/or disorders, such as cholesterol, as described by Zhang ‘770 and Mintier.
It would have been obvious to one of ordinary skill in the art to have tried to arrive at a guide RNA comprising instant SEQ ID NO: 943 for the following reasons. The PCSK9 gene sequence was known as illustrated by NM_174936.3. In addition, the obviousness of targeting and converting a cytosine to thymine to introduce a stop codon is discussed above. Based on these disclosures, one of ordinary skill in the art would have been in need of identifying a cytosine that, when converted into thymine, would result in a stop codon and further wherein the nucleotide sequence meets the criteria of an acceptable guide sequence including the presence of the PAM. However, there would have been a finite number of possible guide sequence candidates that would have met these characteristics based on the PCSK9 gene sequence as illustrated by NM_174936.3. The guide sequence of SEQ ID NO: 943 meets these criteria including it being 20 nucleotides in length, the presence of an upstream TGG (i.e., NGG PAM sequence motif), the targeted cytosine is centered within the target sequence, and C to T conversion in the central cytosine would result in the conversion of the codon TGG to the stop codon TAG in the complementary strand. In addition, one of ordinary skill in the art would have so recognized SEQ ID NO: 943 as such an attractive guide sequence based on the high level of skill in the art, the knowledge of the PCSK9 gene sequence as illustrated by NM_174936.3, and further the knowledge in the art regarding desirable guide sequences as discussed by Zhang ‘770. Accordingly, one of ordinary skill in the art could have modified a guide RNA that targets PCSK9 to comprise the guide sequence of SEQ ID NO 943 and it would have been entirely predictable that such a guide sequence would have been useful for the targeting and conversion of a target cytosine for the introduction of a stop codon into the PCSK9 gene sequence.
For additional limitations of the instant claims, see the additional teachings of the patented claims. To the extent that there are limitations that are not provided for by the patented claims, the teachings of Zhang ‘770, Mintier, Liu, NM_174936.3, YP_009283008.1, Doudna, Zhang ‘243, and Ai are discussed above. It would have been obvious to have modified the subject matter of the patented claims to arrive at the subject matter of the instant claims for substantially the same reasons as discussed above in view of the teachings of these references.

Claims 1-4, 6, 14, 34, 70, 110, 124, 129-133, 135-141, 144-146, and 148-161 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1-23 of US Patent 11214780B2 in view of Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), Liu (US 2015/0166980), NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages), YP_009283008.1 (Bacillus phage AR9 uracil DNA glycosylase inhibitor, NCBI Reference Sequence, priority to September 23, 2016, 2 pages), Doudna (US 2014/0068797), and Zhang (US 2016/0208243, published July 21, 2016 and filed December 18, 2015, hereinafter referred to as Zhang ‘243) and (Ai et al. 2016. Biochemistry & Molecular Biology Journal Vol. 2 No. 3: 17).
The patented claims recite a fusion protein comprising a deaminase domain with a base excision repair inhibitor and further a guide nucleic acid-binding domain, wherein the deaminase domain is a cytosine deaminase, wherein the base excision repair inhibitor is a uracil glycosylase inhibitor. The patented claims further teach wherein the deaminase domain deaminates a cytosine base in a single-stranded portion of the target nucleic acid sequence.
The patented claims do not teach a method of using the patented fusion protein to target the guide RNA to a target cytosine in PCSK9 that is converted to thymine by the deaminase wherein the C to T change leads to mutation of a single amino acid in the PCSK9 protein selected from the group consisting of W10X, W11X, Q31X, Q90X, Q99X, Q101X, O152X, W156X, Q172X, Q190X, Q219X, Q256X, Q275X, Q278X, Q302X, Q342X, Q344X, Q382X, Q387X, Q413X, W428X, Q433X, W453X, Q454X, W461X, Q503X, Q531X, Q554X, Q555X, W566X, R582X, Q584X, Q587X, Q619X, Q621X, W630X, Q686X, and Q689X, wherein X is a stop codon and wherein the guide nucleotide sequence comprises SEQ ID NO: 943.
However, the teachings of Zhang ‘770, Mintier and NM_174936.3 are discussed above.
It would have been obvious to have combined the patented fusion protein with a guide RNA comprising a guide sequence that targets a targeted cytosine in a gene encoding PCSK9 to arrive at PCSK9 mutants at positions W10, W11, Q31, Q90, Q99, Q101, O152, W156, Q172, Q190, Q219, Q256, Q275, Q278, Q302, Q342, Q344, Q382, Q387, Q413, W428, Q433, W453, Q454, W461, Q503, Q531, Q554, Q555, W566, R582, Q584, Q587, Q619, Q621, W630, Q686, and Q689. One of ordinary skill would be motivated given Zhang ‘770 teachings that PCSk9 is an attractive target for CRISPR to inactivate PCSK9 for cholesterol reduction and Mintier teachings of the specific mutation if PCSK9 that results truncated PCSK9 variants. One would have been motivated and had a reasonable expectation of success to have targeted a cytosine in PCSK9 and converted it into thymine for the advantage of introducing a stop codon and arrive at the PCSK9 mutants which could be screened to be useful for treatment, and/or prevention of various diseases and/or disorders, such as cholesterol, as described by Zhang ‘770 and Mintier.
It would have been obvious to one of ordinary skill in the art to have tried to arrive at a guide RNA comprising instant SEQ ID NO: 943 for the following reasons. The PCSK9 gene sequence was known as illustrated by NM_174936.3. In addition, the obviousness of targeting and converting a cytosine to thymine to introduce a stop codon is discussed above. Based on these disclosures, one of ordinary skill in the art would have been in need of identifying a cytosine that, when converted into thymine, would result in a stop codon and further wherein the nucleotide sequence meets the criteria of an acceptable guide sequence including the presence of the PAM. However, there would have been a finite number of possible guide sequence candidates that would have met these characteristics based on the PCSK9 gene sequence as illustrated by NM_174936.3. The guide sequence of SEQ ID NO: 943 meets these criteria including it being 20 nucleotides in length, the presence of an upstream TGG (i.e., NGG PAM sequence motif), the targeted cytosine is centered within the target sequence, and C to T conversion in the central cytosine would result in the conversion of the codon TGG to the stop codon TAG in the complementary strand. In addition, one of ordinary skill in the art would have so recognized SEQ ID NO: 943 as such an attractive guide sequence based on the high level of skill in the art, the knowledge of the PCSK9 gene sequence as illustrated by NM_174936.3, and further the knowledge in the art regarding desirable guide sequences as discussed by Zhang ‘770. Accordingly, one of ordinary skill in the art could have modified a guide RNA that targets PCSK9 to comprise the guide sequence of SEQ ID NO 943 and it would have been entirely predictable that such a guide sequence would have been useful for the targeting and conversion of a target cytosine for the introduction of a stop codon into the PCSK9 gene sequence.
For additional limitations of the instant claims, see the additional teachings of the patented claims. To the extent that there are limitations that are not provided for by the patented claims, the teachings of Zhang ‘770, Mintier, Liu, NM_174936.3, YP_009283008.1, Doudna, Zhang ‘243, and Ai are discussed above. It would have been obvious to have modified the subject matter of the patented claims to arrive at the subject matter of the instant claims for substantially the same reasons as discussed above in view of the teachings of these references.

Claims 1-4, 6, 14, 34, 70, 110, 124, 129-133, 135-141, 144-146, and 148-161 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1-26 of US Patent 11268082B2 in view of Zhang (US 2014/0179770, herein referred to as Zhang ‘770), Mintier (US 2008/0008697 A1), Liu (US 2015/0166980), NM_174936.3 (Homo sapiens proprotein convertase subtilisin/kexin type 9 (PCSK9) transcript variant 1, mRNA, NCBI Reference Sequence, priority to October 28, 2015, 6 pages), YP_009283008.1 (Bacillus phage AR9 uracil DNA glycosylase inhibitor, NCBI Reference Sequence, priority to September 23, 2016, 2 pages), Doudna (US 2014/0068797), and Zhang (US 2016/0208243, published July 21, 2016 and filed December 18, 2015, hereinafter referred to as Zhang ‘243), and (Ai et al. 2016. Biochemistry & Molecular Biology Journal Vol. 2 No. 3: 17).
The patented claims recite a fusion protein comprising a cytidine deaminase domain with a nucleic acid programmable DNA binding protein and further a uracil glycosylase inhibitor domain. The patented claims further teach wherein the nucleic acid programmable DNA binding protein is a Cas9 nickase.
The patented claims do not teach a method of using the patented fusion protein to target the guide RNA to a target cytosine in PCSK9 that is converted to thymine by the deaminase wherein the C to T change leads to mutation of a single amino acid in the PCSK9 protein selected from the group consisting of W10X, W11X, Q31X, Q90X, Q99X, Q101X, O152X, W156X, Q172X, Q190X, Q219X, Q256X, Q275X, Q278X, Q302X, Q342X, Q344X, Q382X, Q387X, Q413X, W428X, Q433X, W453X, Q454X, W461X, Q503X, Q531X, Q554X, Q555X, W566X, R582X, Q584X, Q587X, Q619X, Q621X, W630X, Q686X, and Q689X, wherein X is a stop codon and wherein the guide nucleotide sequence comprises SEQ ID NO: 943.
However, the teachings of Zhang ‘770, Mintier and NM_174936.3 are discussed above.
It would have been obvious to have combined the patented fusion protein with a guide RNA comprising a guide sequence that targets a targeted cytosine in a gene encoding PCSK9 to arrive at PCSK9 mutants at positions W10, W11, Q31, Q90, Q99, Q101, O152, W156, Q172, Q190, Q219, Q256, Q275, Q278, Q302, Q342, Q344, Q382, Q387, Q413, W428, Q433, W453, Q454, W461, Q503, Q531, Q554, Q555, W566, R582, Q584, Q587, Q619, Q621, W630, Q686, and Q689. One of ordinary skill would be motivated given Zhang ‘770 teachings that PCSk9 is an attractive target for CRISPR to inactivate PCSK9 for cholesterol reduction and Mintier teachings of the specific mutation if PCSK9 that results truncated PCSK9 variants. One would have been motivated and had a reasonable expectation of success to have targeted a cytosine in PCSK9 and converted it into thymine for the advantage of introducing a stop codon and arrive at the PCSK9 mutants which could be screened to be useful for treatment, and/or prevention of various diseases and/or disorders, such as cholesterol, as described by Zhang ‘770 and Mintier.
It would have been obvious to one of ordinary skill in the art to have tried to arrive at a guide RNA comprising instant SEQ ID NO: 943 for the following reasons. The PCSK9 gene sequence was known as illustrated by NM_174936.3. In addition, the obviousness of targeting and converting a cytosine to thymine to introduce a stop codon is discussed above. Based on these disclosures, one of ordinary skill in the art would have been in need of identifying a cytosine that, when converted into thymine, would result in a stop codon and further wherein the nucleotide sequence meets the criteria of an acceptable guide sequence including the presence of the PAM. However, there would have been a finite number of possible guide sequence candidates that would have met these characteristics based on the PCSK9 gene sequence as illustrated by NM_174936.3. The guide sequence of SEQ ID NO: 943 meets these criteria including it being 20 nucleotides in length, the presence of an upstream TGG (i.e., NGG PAM sequence motif), the targeted cytosine is centered within the target sequence, and C to T conversion in the central cytosine would result in the conversion of the codon TGG to the stop codon TAG in the complementary strand. In addition, one of ordinary skill in the art would have so recognized SEQ ID NO: 943 as such an attractive guide sequence based on the high level of skill in the art, the knowledge of the PCSK9 gene sequence as illustrated by NM_174936.3, and further the knowledge in the art regarding desirable guide sequences as discussed by Zhang ‘770. Accordingly, one of ordinary skill in the art could have modified a guide RNA that targets PCSK9 to comprise the guide sequence of SEQ ID NO 943 and it would have been entirely predictable that such a guide sequence would have been useful for the targeting and conversion of a target cytosine for the introduction of a stop codon into the PCSK9 gene sequence.
For additional limitations of the instant claims, see the additional teachings of the patented claims. To the extent that there are limitations that are not provided for by the patented claims, the teachings of Zhang ‘770, Mintier, Liu, NM_174936.3, YP_009283008.1, Doudna, Zhang ‘243, and Ai are discussed above. It would have been obvious to have modified the subject matter of the patented claims to arrive at the subject matter of the instant claims for substantially the same reasons as discussed above in view of the teachings of these references.

Response to Arguments
Applicant's arguments filed 23 January 2025 have been fully considered but they are not persuasive. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
Applicant’s argue that NM_174936.3 fails to teach or suggest a guide nucleotide sequence comprising any one of SEQ ID NOs: 938-1123, as recited in the amended claims. Applicant’s argue that there is no motivation provided for a skilled artisan to arrive at those particular sequences as none of the cited references provide a motivation to arrive at the specific guide sequence comprising SEQ ID NO: 943 or any of the other specific sequences recited in the claims. Applicant’s arguments have been considered and are found not persuasives. NM_174936.3 teaches the reference sequence for PCSK9, and due to the wealth of knowledge related to choosing a gRNA for CRISPR-Cas editing which includes the requirement of a specific PAM sequence, the relation of the target sequence to the PAM sequence, the uniqueness of the sequence in comparison to the rest of the genome, and the need for there to be the generation of a stop codon after a C to T conversion, one of ordinary skill would be motivated to arrive at the specific guide sequence comprising SEQ ID NO: 943 or any of the other specific sequences that meet these specific characteristics as recited in the claims.
Applicants argue that there is no requirement that a guide nucleotide sequence be exactly 20 nucleotides in length, and indeed, SEQ ID NOs: 938-1123 include guide nucleotide sequences that are greater than or less than 20 nucleotides in length. Applicants argue that there is no requirement that a guide sequence contain the target nucleotide to be mutated at the center of the guide sequence. Applicant’s arguments have been considered and are found not persuasives. Nishida teaches that the gRNA length was 20 base pairs [0159]. Nishida also teaches mutations in the center of the target sequence and the ability to pinpoint the introduction of mutations [0138]. Therefore, although there is no requirements for these specific embodiments, a skilled artisan equipped with the teachings of Nishida would be motivated to choose a 20 nucleotide in length gRNA that will yield a mutation in the center of the target sequence which is within the PCSK9 gene for these reasons and for the reasons as discussed in the rejection above to arrive at the claimed invention.

In response to the NSDP rejections, Applicant’s argue that none of the cited references, including NM_174936.3, teach or suggest a guide nucleotide sequence comprising any one of SEQ ID NOs: 938-1123, in accordance with the claimed invention. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Furthermore, the combination of references do suggest a guide nucleotide sequence comprising any one of SEQ ID NOs: 938-1123, in accordance with the claimed invention, as discussed above. Therefore, the NSDP rejections remain.

Allowable Subject Matter
Claim 147 is being objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening clams. Claim 147 is directed to a method of editing a PCSK9 protein by contacting PCSK9 with a fusion protein and a guide nucleotide sequence that targets the fusion protein to introduce a premature stop codon (C to T mutation) after a structurally destabilizing mutation selected from P530S/L, P581S/L, and P618S/L in the protein to create a truncated, loss of function PCSK9 protein. The closest prior art is Nishida as discussed above. Although the addition of Ai who teaches that the S462P and A552T PCSK9 mutations are structurally destabilizing mutations as discussed above, Ai nor the prior teach or suggest a P530S/L, P581S/L, or P618S/L PCSK9 mutation.

Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIFFANY N GROOMS whose telephone number is (571)272-3771. The examiner can normally be reached M-F 830-530.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.

/TIFFANY NICOLE GROOMS/Examiner, Art Unit 1637